Labshake search
Citations for Takara Bio :
901 - 950 of 2510 citations for Acetamide N 2 3 dihydro 2 3 hydroxy 2 quinolinyl 1 3 dioxo 1H inden 5 yl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... A volume of 2 µl of cDNA was used as template for qPCR using SYBR Premix Ex Taq (Takara, Shiga, Japan, #RR420A). qPCR reactions were performed using an ABI 7500 system (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... nine DNA fragments encoding the partial genome of SARS-CoV-2 (hCoV-19/Japan/TY-WK-521/2020) were amplified by PCR using PrimeSTAR GXL DNA polymerase (Takara, Cat# R050A). A linker fragment encoding the hepatitis delta virus ribozyme ...
-
bioRxiv - Microbiology 2023Quote: ... The amplicons were analyzed using 2% agarose gel electrophoresis with ethidium bromide staining and using a 2000-bp DNA ladder marker (Takara, Tokyo, Japan).
-
bioRxiv - Genomics 2023Quote: ... the human mtDNA control region (m.1-573 and m.16024-16569) was enriched using four overlapping PCR amplicons using high fidelity TaKaRa PrimeSTAR GXL DNA polymerase (TaKaRa; Table 2). PCR products were visually inspected by agarose gel ...
-
bioRxiv - Biophysics 2023Quote: ... Cell debris was pelleted down and the supernatant was run on a 2 mL column volume (CV) TALON cobalt affinity resin (Takara Bio #635504) equilibrated in CoWB/TCEP (100 mM NaCl (Sigma-Aldrich 746398) ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 2 μL of cDNA product was used for subsequent RT–qPCR analysis using SYBR1 Premix Ex Taq (Takara, Dalian, Japan). All primers used in this study are shown in Table S1.
-
bioRxiv - Microbiology 2023Quote: ... of the resulting fragments were subjected to a CPER reaction in a 50 μl volume using 2 μl of PrimeStar GXL DNA polymerase (Takara Bio; #R050A). The following cycling conditions were used for CPER ...
-
bioRxiv - Genetics 2023Quote: ... RNA from 2 retinae of a mouse was extracted using the NucleoSpin® RNA kits (Takara Bio USA, Inc., San Jose, CA). RNA sample concentration and quality was determined with NanoDrop Oneᶜ Microvolume UV-Vis Spectrophotometers (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... cDNA library was generated from 2 nanograms of total RNA using Smart-Seq V4 Ultra Low Input RNA Kit (Takara catalog#: 634894). 150 picograms of cDNA was used to make sequencing libraries by Nextera XT DNA Sample Preparation Kit (Illumina catalog# ...
-
bioRxiv - Genetics 2024Quote: ... The reaction was performed in a 20 µl reaction mixtures comprising 10 µl of 2×TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (Cat. no. RR420A, TaKaRa), 1 µl of cDNA ...
-
bioRxiv - Genetics 2024Quote: ... The reaction was performed in a 20 µl reaction mixtures comprising 10 µl of 2×TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (Cat#RR420A, TaKaRa), 1 µl of cDNA ...
-
bioRxiv - Plant Biology 2024Quote: ... A volume of 2 µg of total RNA was reverse transcribed into single-stranded cDNA using AMV reverse transcriptase (TaKaRa, Dalian, China). The primer sequences used for qRT-PCR are listed in Supplementary file 1b ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% normal donkey serum) for 1h at room temperature followed by incubation in primary antibodies (rabbit anti Ds-red, Takara, cat# 632496 ...
-
bioRxiv - Cell Biology 2020Quote: ... and Evl (isoform 2) were amplified by PCR from a NIH 3T3 cDNA library and ligated into suitable sites of pEGFP-C1 (Clontech, Palo Alto, CA). VASP cDNA was additionally inserted into the BglII and SalI sites of pmCherry (Addgene ID ...
-
bioRxiv - Plant Biology 2020Quote: ... About 2 μg of the isolated RNA was used to synthesize the first-strand cDNA using reverse transcriptase enzyme (Takara Bio, Clontech, USA). The cDNA was diluted seven times with sterile Milli-Q water (1:7 ratio) ...
-
bioRxiv - Cell Biology 2022Quote: ... Transformants were selected on synthetic media containing yeast nitrogen base (YNB, Difco) supplemented with 2 % glucose and DropOut supplements lacking uracil (Clontech, Mountain View, CA). Single colonies were used to inoculate 5 mL liquid YNB media supplemented with 2 % glucose and DropOut supplements lacking uracil ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... containing a Kozak sequence added right before the ATG (RefSeq NC_045512.2) were synthesized by Eurofins (Ebersberg, EU) and subcloned into the pIRES2 vector with eGFP in the second cassette (Takara Bio Europe, EU). Truncated Δ4 and Δ8 E proteins ...
-
bioRxiv - Genetics 2024Quote: ... PCR was conducted as described earlier (section: RNAi-mediated knockdown of Pmtra-2) but using the proofreading PrimeSTAR HS DNA Polymerase (Takara Bio, Shiga, Japan) and Ex Taq DNA Polymerase (Takara Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed by quantitative real-time polymerase chain reaction (PCR) using the AAVpro™ Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Microbiology 2024Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C in a vertical rotating mixer (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... a Tet responsive 2 promoter comprised of seven repeats of TRE binding sites and a minimal CMV promoter (based on that in Clontech’s pTRE2-hyg vector), a loxP site ...
-
bioRxiv - Immunology 2022Quote: ... pmCherry-N’ (Clontech) between NheI and HindIII restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...
-
bioRxiv - Physiology 2024Quote: ... with 2 ul of RNAse inhibitor mix (containing 0.12 ul Triton X-100 10 %, 0.1 ul RNAse inhibitor (Takara (Cat. No. 2313B, 40 U/ul), 1.78 ul MilliQ water (RNAse-free)) ...
-
bioRxiv - Microbiology 2024Quote: ... the ORF4 region was amplified by RT-PCR with specific primers (Supplementary Table S2) using PrimeScript One Step RT-PCR Kit Ver.2 (Takara Bio Inc., Kusatsu, Japan), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The PCR-amplified promoter fragments were inserted into the XhoI-AgeI site of the pAAV using Ligation high Ver.2 (LGK-201; Toyobo: hGFAP(ABC1D) or In-Fusion HD Cloning Kit (Takara Bio, Shiga, Japan: mMBP promoter).
-
bioRxiv - Developmental Biology 2022Quote: Trophectoderm biopsies containing 5-10 cells from blastocyst-stage embryos (n=24) were processed for RNA-seq using a commercial kit (Takara Bio ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding the PX domain from the Qc SNARE Vam7 (Amino acyl residues 2-123) was amplified by PCR with CloneAMP HiFi PCR premix (Takara Bio USA, Mountain View, CA, USA). The amplified DNA fragment was cloned into BamHI and SalI digested pGST parallel1 vector (Sheffield et al.,1999 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were anti-PLP (N-terminus; 1:5000, Rogers, 2008) anti-GFP (JL8; 1:2000 – 5000; Clontech); anti-alpha-Tubulin (DM1A ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 grams or more of brain tissue was thawed on ice for 5 minutes with 5 ml of nuclei buffer (NB): 1% BSA containing 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl 5× In-Fusion Enzyme Mix (Takara) were mixed in a total of 5 µl H2O ...
-
bioRxiv - Physiology 2020Quote: ... N-glycosidase F (PNGase, Takara, 4450) was used as previously reported [22] ...
-
bioRxiv - Neuroscience 2020Quote: Genomic-free total RNA was isolated from a separate cohort of E15.5 sham control and IUGR hippocampi (n=4-5/each treatment) using Nucleospin RNA protocol (Takara Bio USA, Mountain View, CA). Total RNA was quantified with a Nanodrop spectrophotometer ND-1000 (Wilmington ...
-
bioRxiv - Molecular Biology 2020Quote: ... Aliquots of total RNA (1 μg) were reverse transcribed using pd(N)6 random primer (Takara Bio) and Moloney murine leukemia virus (M-MLV ...
-
bioRxiv - Genetics 2024Quote: ... 1–1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, CA). For non-cleavable INF2 ...
-
bioRxiv - Systems Biology 2020Quote: ... or pCMV-HA-N vector (Clontech #635690), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... and cloned into pmRFP-N vectors (Clontech). A construct coding for N-terminally GFP-tagged full-length rat Shank3 in the pHAGE vector was obtained from Alex Shcheglovitov (University of Utah) ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Cancer Biology 2023Quote: ... The H2afx coding sequence from Mus musculus was ordered from Eurofins and cloned into the pOZ-N-FH backbone adding the 1xHA tag at the N terminus using the in-fusion HD cloning kit (#12141, Takara). Full length wild type H2afx coding sequence was then mutagenized to obtain the desired S139A point mutation.
-
bioRxiv - Developmental Biology 2023Quote: ... They were then incubated O/N at 4°C with the corresponding primary antibody: anti-DsRed (1:500; Clontech), mouse anti-GFP ([1:100] ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed for 1h at room temperature (RT) with a mouse anti-GFP antibody (Living Colors -JL-8, BD Biosciences Clontech) in TBS-T buffer (20 mM Tris ...
-
bioRxiv - Biophysics 2021Quote: ... AY457063.1) and PIKfyve-KYA hyperactive mutant (E1620>K, N1630>Y, S2068>A) were cloned into PCMV-HA-N vector (Clontech) and gifted by Lois Weisman lab ...