Labshake search
Citations for Takara Bio :
901 - 950 of 2465 citations for 5 1 3 benzothiazol 2 ylamino pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Primers were designed using the Takara Bio Perfect Real Time Support System (Takara Bio, Table 2). Primers were diluted to 50 µM in ddH20 and stored at -20°C ...
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viral supernatant was collected 2 days post-transfection and concentrated using Lenti-X lentivirus concentrator (Clontech). Cells were then infected with the concentrated lentivirus ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using 2 μg RNA and PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Molecular Biology 2024Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pM ...
-
bioRxiv - Plant Biology 2024Quote: ... The 20-ml reaction mixture contained 10 ml of 2× TB Green Premix Ex Taq (Takara), 2 ml of diluted complementary DNA (1:5) ...
-
bioRxiv - Bioengineering 2024Quote: ... 500 ng of RNA was mixed with 2 μl of PrimeScriptTM RT reagent kit (TaKaRa, RR037B) and distilled water (DW ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The supernatant was applied to 2 mL slurry of TALON Metal Affinity Resin (Takara Bio #635504) and nutated for 1 hour to allow TALON to bind the His tagged protein ...
-
bioRxiv - Cancer Biology 2020Quote: ... Amplified cDNA from the ICELL8® 3’ DE Chip individual cells was collected and pooled using the ICELL8® Collection Kit (Takara Bio) by centrifugation at 3,200 x g ...
-
bioRxiv - Microbiology 2020Quote: pEX18Tc-hpdA was constructed for gene knockout by fusing the erythromycin resistance gene and two upstream and downstream fragments of the target gene amplified with the primers shown in Table 3 to Sac I/Hind III-digested pEX18Tc with the In-Fusion® HD Cloning Kit (TaKaRa, Dalian, China). The resulting plasmid pEX18Tc-hpdA was transformed into E ...
-
bioRxiv - Microbiology 2023Quote: ... or the BamHI/MluI site of pWPI-ACE2-zeo (for ACE2 expression plasmids)43 with 3×FLAG-tag at the C-terminus using In-Fusion® HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transfected cells were cultured for over 3 weeks in complete RPMI-1640 medium containing G418 (600 μg/ml; Clontech, Palo Alto, CA, USA) to select resistant clones.
-
bioRxiv - Neuroscience 2023Quote: ... Media containing lentiviral particles was collected 72 hours post-transfection and the lentiviral particles were precipitated with 3 volumes of Lenti-X Concentrator (Takara, cat. no. 631232) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 µM of Shield-1 peptide (Clontech, Mountain View CA) for 4-6 hours ...
-
bioRxiv - Molecular Biology 2024Quote: - IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Molecular Biology 2024Quote: IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μM of Shield-1 peptide (Clontech, Mountain View CA) for 4 h ...
-
bioRxiv - Cell Biology 2024Quote: ... 1× Titanium Taq buffer and 1 μL Titanium Taq (Clontech, 639209). PCR cycles were ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and mCherry were isolated by PCR from various templates and inserted into the pGL4.23-(C120×5)-TATA vector with In-Fusion cloning (Clontech) according to manufacturer instructions using a 1:2 vector-to-insert ratio to generate optogenetic response plasmids ...
-
bioRxiv - Cancer Biology 2020Quote: ... 105 tumor cells in 6-well culture vessels were transfected with 5 μg DNA using XFect (Takara, Kusatsu, Japan) and clones were selected by puromycin (2-10 μg/mL).
-
bioRxiv - Microbiology 2022Quote: ... The 5’ end regions of MIC14 and MIC15 were amplified using the SMART RACE cDNA Amplification Kit (Clontech BD) using total or poly(A)+tachyzoite RNA (strain RH ...
-
bioRxiv - Molecular Biology 2022Quote: ... bound RNAs were eluted via 30min incubation at 55°C in wash buffer supplemented with 0.5 μg/μL Proteinase K and 0.1% SDS and isolated using Qiazol/chloroform separation and NucleoSpin RNA columns (Takara). Luciferase control RNA is spiked in to each sample (5ng/sample ...
-
bioRxiv - Biochemistry 2021Quote: ... prepared as described above was mixed with imidazole (5 mM) and 0.5 mL of Talon superflow metal affinity resin (Clontech) that had been equilibrated with buffer (as above for magnetic agarose) ...
-
bioRxiv - Genomics 2022Quote: ... IgG and IgM 5’RACE AIRR-seq libraries were generated using the SMARTer Human BCR Profiling Kit (Takara Bio), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The supernatants were collected and applied to a column filled with 5 ml of TALON Metal Affinity resin (Takara) previously equilibrated with ice-cold PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’ UTR and EGFPd2 sequences were cloned in the multiple cloning site of pTet-One vector (Takara-Clontech, 634301). DG NSC Droshafl/fl cells were brought in suspension by incubating with 0.25% trypsin (Gibco #15090 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’ UTR and EGFPd2 sequences were cloned in the multiple cloning site of pTet-One vector (Takara-Clontech, 634301). DG NSC Droshafl/fl cells were brought in suspension by incubating with 0.25% trypsin (Gibco #15090 ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μl of the reaction mixture was prepared with 5 μl of SapphireAmp Fast PCR Master Mix (Takara #RR350B), 1 μl of each of forward and reverse primers (final concentration 0.2 μM) ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 100 microglia from each region were collected in 5 μL single-cell lysis buffer (635013, Takara), and flash-frozen on dry ice.
-
bioRxiv - Immunology 2024Quote: ... The lysate was incubated at 37°C for 5 min and subjected to IMAC purification using TALON beads (Clontech). The eluate was concentrated by ultrafiltration using 10 kDa cut-off Vivaspin (Sartorius ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR analysis was then performed with 1.0 μl of 5-fold diluted cDNA using a SYBR premixed Ex Taq kit (Takara), and a Light Cycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Genetics 2024Quote: ... The lysate was centrifuged at 35,000 rpm for 45 mins and the supernatant was applied to 5 ml Talon resin (Takara) equilibrated with the binding buffer (25 mM Tris-HCl [pH7.5] ...
-
bioRxiv - Genomics 2020Quote: ... RNase Inhibitor (0.4 U) and 1.92 μM of the 3’ oligo dT terminating primer: SMART-Seq® ICELL8® CDS (Takara Bio USA, CA, USA).
-
bioRxiv - Biochemistry 2021Quote: ... (ii) addition of a second adapter on the 3’ end of the cDNA during reverse transcription using SmartScribe RT (Clontech Biotechnologies, Mountain View, CA) as previously described (63) ...
-
bioRxiv - Immunology 2020Quote: ... Virus concentration was estimated by p24 titration using the FLAQ assay76 (HIVGKO and VLPs) or the Lenti-X™ p24 Rapid Titer Kit (Clontech; HIVNL4-3/Luciferase).
-
bioRxiv - Developmental Biology 2020Quote: ... Lentiviral supernatant titers were determined by Lenti-X p24 Rapid Titer Kit (supplemental Table 3) according to manufacturer’s protocol (Takara Bio USA, Inc. California, U.S.A).
-
bioRxiv - Developmental Biology 2021Quote: PCR products were subcloned in frame with GFP sequence in 3′ into pCS2+-GFP vector using In-Fusion® HD Cloning Kit (Takara Bio USA, Inc.). For rescue experiments ...