Labshake search
Citations for Takara Bio :
851 - 900 of 3733 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthetized using the PrimeScript™ RT Reagent Kit (Takara #RR037A) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and reverse-transcribed into cDNA using Superscript RT Master Mix (Takara, Japan) as recommended by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... which was reverse transcribed using the PrimerScriptTM RT reagent Kit (TaKaRa, RR037A) to obtain cDNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR was performed with SYBR green master mix (Takara, Dalian, China) on the ABI Step One System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthesized using PrimeScriptTM RT reagent kit (Takara, catalog no. RR037A), and qPCR analysis was done with power SYBR Green PCR master mix (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... mRNA was reverse transcribed to cDNA with the PrimeScript RT kit (TaKaRa). cDNA was analysed by real-time PCR with the Light Cycler 480 SYBR Green I Master Mix (Roche) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was made using 500ng RNA with PrimeScript RT Reagent Kit (TaKaRa). Real time PCR was set up using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse transcription was performed using the PrimeScript RT reagent kit (Takara, Japan). The qRT-PCR was conducted using a CFX384 Real-Time PCR System (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... and reverse transcribed into cDNA with PrimeScript RT Master Mix (Takara, RR036A). The real-time polymerase chain reaction was performed using iQ SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... and cDNA was prepared using the Prime Script RT reagent kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR reactions were performed using CloneAmp™ HiFi PCR Premix (Takara) for 35 cycles with an annealing temperature of 52 °C according to the manufacturer’s suggestions ...
-
bioRxiv - Immunology 2021Quote: ... with the Power PCR TB green PCR master mix (Takara, Japan). 2µl of sample cDNA was used in a total volume of 10µl (3µl primer mix and 5µl of TB green ...
-
bioRxiv - Microbiology 2019Quote: PCR were performed using the Terra PCR Direct Polymerase Mix (Clontech) directly on the cell lysates using the following primers:
-
bioRxiv - Microbiology 2019Quote: PCR were performed using the Terra PCR Direct Polymerase Mix (Clontech) directly on the cell lysates after each round of co-infection ...
-
bioRxiv - Biochemistry 2019Quote: ... The PCR products were extracted with PCR purification kits (Takara 9761) and ligated using a Blunting Kination Ligation Kit (Takara 6217) ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was PCR-amplified using Terra PCR Direct Polymerase (Takara Bio). Final libraries were prepared using 1ng of cDNA per library with the Nextera XT kit (Illumina ...
-
bioRxiv - Genetics 2020Quote: ... The PCR was done in PrimeStar GXL PCR reaction (TaKaRa, R050A). The primer sequences are:
-
bioRxiv - Immunology 2023Quote: ... PCR was performed on a PCR thermal cycler (Takara, Tokyo, Japan) and real-time PCR was performed using QuantStudio 3 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Each PCR reaction was composed of CloneAmp HiFi PCR premix (Takara), 4ng of the plasmid template and 10-20ng of the primer pair mix ...
-
bioRxiv - Microbiology 2024Quote: ... PCR DNA amplifications were performed with CloneAmp HiFi PCR premix (Takara) using Primer-AP (5’ GACCACGCGTATCGATGTCGAC 3’ ...
-
bioRxiv - Plant Biology 2024Quote: ... All PCR reactions were performed using the PCR components from Takara bio Inc ...
-
bioRxiv - Pathology 2019Quote: ... Corresponding cDNA was obtained using reverse transcriptase and Oligo (dT) 18 primer (TaKaRa). An aliquot of the cDNA was mixed with 25 µL SYBR® Green PCR Master Mix (TaKaRa ...
-
bioRxiv - Plant Biology 2019Quote: ... and 0.6 μl of 100 μM random primer (N)6 (TaKaRa, Kusatsu, Japan), with RNase-free water added up to 20 μl ...
-
bioRxiv - Physiology 2021Quote: ... primers included oligonucleotide overhangs for In-Fusion Cloning (Clontech, Mountain View, CA, USA) into a pCR2.1-TOPO vector (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Synthetic Biology 2022Quote: ... KO primers with 50 bp homologous overhangs and PrimeStar GXL polymerase (Takara Bio) was performed to generate chloramphenicol (CapR ...
-
bioRxiv - Microbiology 2023Quote: ... templates with primers encoding a His-tag and NcoI/NotI cut sites (Takara), cloned into pET22b ...
-
bioRxiv - Molecular Biology 2022Quote: ... then mixed with universal primer and PrimeSTAR GXL DNA polymerase (Takara, Cat# R050A) and amplified following the program ...
-
bioRxiv - Microbiology 2021Quote: ... column was equilibrated with 10 column volumes of Equilibration Buffer (HisTALON™ Buffer Set, Clontech Laboratories, Cat# 635651). The filtered supernatant was loaded onto the HisTALON cartridge (Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... All elements of the DiCre plasmid were amplified by PCR using standard PCR conditions (using the CloneAmp HiFi PCR premix) and sequentially ligated (In-Fusion HD Cloning Kit, Clontech) into an acceptor plasmid containing a TgDHFR/TS cassette flanked by two LoxP sites ...
-
bioRxiv - Developmental Biology 2024Quote: ... Quantitative PCR (qPCR) was performed on the CFX Connect Real-Time PCR Detection System using SYBR Green PCR Master Mix (TaKaRa). Primer pairs used were listed in Supplementary (Table S2) ...
-
bioRxiv - Plant Biology 2024Quote: ... The qRT-PCR analysis was performed using the ABI StepOne Plus PCR system and the SYBR Green Realtime PCR mix (Takara). The ubiquitin gene (Lj5g3v2060710 ...
-
bioRxiv - Neuroscience 2021Quote: ... Real time PCR was done via Real-time PCR equipment TP970 (Takara) and analyzed by Thermal Cycler Dice® Real Time System (Takara).
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara).
-
bioRxiv - Cell Biology 2021Quote: ... open reading frames were PCR-amplified using CloneAmp HiFi PCR Premix (Clontech), gel-purified using the Nucleospin® Gel and PCR Clean-Up kit (Macherey-Nagel) ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCR was performed with EmeraldAmp MAX PCR Master Mix (Takara). Primers for amlplication of Piezo1 and Gapdh genes were listed in our previous study [26].
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCR was carried out using SYBR Green Q-PCR kit (Takara). Relative expression with respect to control (act2 gene ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR for Gibson assembly was performed using CloneAmp HiFi PCR Premix (Clontech) and Q5 high-fidelity DNA polymerase (NEB) ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR amplification was performed using SYBR Green PCR master mix (Takara) using 10ng of cDNA and 200nM of each specific primer on a 7500 Fast Real-PCR system (Applied Biosystems) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The PCR products were purified using NucleoSpin PCR clean-up kit (Takara).
-
bioRxiv - Immunology 2023Quote: ... The PCR protocol was executed using the Sapphire PCR master mix (TAKARA) following manufacturer protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was converted to cDNA using the PrimeScript RT reagent Kit (Takara, RR037A).
-
bioRxiv - Cell Biology 2020Quote: ... After cDNA was synthesized using the PrimeScript RT Reagent Kit (Takara, Dalian, China) and measured using a CFX96™ real-time PCR detection system (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was reverse-transcribed using PrimeScript™ RT Master Mix (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... and subjected to reverse-transcription using a PrimeScript™ RT Reagent Kit (Takara Biotechnology ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized using a PrimeScript® RT Reagent Kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... cDNA was obtained from 500 ng RNA using PrimeScript RT reagent Kit (Takara). Expression studies were carried out by real-time reverse transcription polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Immunology 2019Quote: ... cDNA was generated by reverse transcription with commercial PrimeScript RT Master Mix (Takara). Primer pairs (Table S12 ...
-
bioRxiv - Cell Biology 2019Quote: ... One µg of total RNA was reverse-transcribed using PrimeScript RT reagent (TaKaRa) with oligo dT primers ...
-
bioRxiv - Immunology 2021Quote: ... and reverse transcribed to cDNA with PrimeScript™ RT reagent Kit (Takara Biotechnology). Gene expression was detected using SYBR green Premix (Takara Biotechnology ...