Labshake search
Citations for Takara Bio :
851 - 900 of 5037 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... using the In-Fusion HD EcoDry cloning kit (Takara Bio), resulting in the plasmid pDriveΔsrtA ...
-
bioRxiv - Microbiology 2020Quote: ... First strand cDNA was synthesized using PrimeScript RT kit (TakaRa). Optimized ddPCR was used to detect the presence of SARS-CoV-2 viruses following our previous study.10 Analysis of the ddPCR data was performed with QuantaSoft software (Bio-Rad) ...
-
bioRxiv - Physiology 2021Quote: ... The SMART-Seq Single Cell Kit (SSsc; Cat. # 634472, Takara) was used and reaction volumes were miniaturized 6 times with the aid of the Mosquito HV robot as per the kit provider User Guide (cDNA synthesis using the mosquito HV genomics with the SMART-Seq® Single Cell Kit ...
-
bioRxiv - Biochemistry 2021Quote: ... In-Fusion HD cloning kit (638909) was purchased from Takara. All enzymes and buffers used in cloning were purchased from New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected using the CalPhos Mammalian Transfection Kit (Clontech) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was synthesized using the PrimeScript RT reagent kit (Takara). Real-time quantitative PCR was performed in triplicate using the SYBR Premix Ex Taq (Tli RNase H Plus ...
-
bioRxiv - Cell Biology 2021Quote: All Lenti-X products and kits were purchased from Takara Bio USA Inc ...
-
bioRxiv - Cell Biology 2020Quote: ... In-Fusion cloning (In-Fusion HD Cloning Plus kit, Clontech) was used to fuse the sh1-resistant MFN2 fragment with the linearized backbone ...
-
bioRxiv - Genomics 2021Quote: The cDNAs were synthesized using SMARTScribe Reverse Transcription Kit (TaKaRa). Two pairs of primers that target either both exons b and c or exon b only were used to amplify these two exons ...
-
bioRxiv - Molecular Biology 2021Quote: ... pRev and pVSVG using CalPhos mammalian transfection kit (TaKaRa Clontech). Next day ...
-
bioRxiv - Molecular Biology 2021Quote: ... pRev and pVSVG using CalPhos mammalian transfection kit (TaKaRa Clontech). Next day ...
-
bioRxiv - Immunology 2020Quote: ... Total RNA was isolated using MN Nucleospin RNA kit (Takara). Equal quantities of RNA were reverse transcribed using Primescript Reverse transcriptase and random hexamers (Takara) ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesized using the PrimeScript RT Reagent Kit (Takara). Quantification of transcripts was performed on a Mx3005P QPCR system (Agilent Technologies ...
-
bioRxiv - Genomics 2021Quote: ... LA Taq HS DNA polymerase kit from TaKaRa (TaKaRa Bio) conveyed the best performance and was therefore further used ...
-
bioRxiv - Genomics 2021Quote: ... using the In-Fusion® HD Cloning Kit (Takara/Clonetech). For transfection of reporter plasmids ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was accomplished with Reverse Transcription Kit (Takara, RR037A) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... A high-fidelity Advantage HF2 PCR kit (Takara, Cat#639123) was used in each of the PCR steps involved in preparing the sequencing libraries ...
-
bioRxiv - Immunology 2022Quote: ... using an In-Fusion ligase-independent cloning kit (Takara-Clontech). The mCITED1 sequence was then subcloned into the pINDUCER20 lentiviral vector (a kind gift from the Weissmiller lab ...
-
bioRxiv - Immunology 2022Quote: ... using an In-Fusion ligase-independent cloning kit (Takara-Clontech). The mCITED1 sequence was then subcloned into the pINDUCER20 lentiviral vector (a kind gift from the Weissmiller lab ...
-
bioRxiv - Neuroscience 2022Quote: ... Viral titers were measured using AAVpro Titration Kit (#6233, Takara) or THUNDERBIRD SYBR qPCR Mix (QPS-201 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The libraries were quantified using the Library quantification kit (Takara) and Thermal cycler Dice Realtime TP800 (Takara ...
-
bioRxiv - Developmental Biology 2022Quote: ... Following purification with Zymoclean Gel DNA Recovery Kit (ZD4008, Takara), product size distribution and quantity were assessed on a Bioanalyzer using an Agilent 2100 high-sensitivity DNA assay kit (5067-4626 ...
-
bioRxiv - Cell Biology 2022Quote: In-Fusion cloning (In-Fusion HD Cloning Plus Kit, Clontech) was used to fuse the fragments with the linearized backbone ...
-
bioRxiv - Genetics 2022Quote: ... The SMART-seq v4 Ultra Low input RNA kit (Clontech) was used to amplify cDNA ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesised using the PrimeScript II kit (Takara Bio). Total RNA and genomic DNA from A ...
-
bioRxiv - Microbiology 2022Quote: ... using the PrimeScript RT reagent Kit with gDNA Eraser (Takara). Real-time qPCR experiments were performed as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... Synthesis of cDNA was performed using cDNA synthesis Kit (Takara). The qPCR was conducted on the Applied Biosystems instrument using the SYBR Green Master Mix ...
-
bioRxiv - Neuroscience 2023Quote: ... SMARTer Stranded Total Sample prep kit-HI Mammalian (Takara, 634875) was used to generate libraries for RNA sequencing.
-
bioRxiv - Neuroscience 2023Quote: ... or PrimeSTAR Mutagenesis Basal kit (Takara Bio Inc., Shiga, Japan): Y156V ...
-
bioRxiv - Plant Biology 2022Quote: ... using an In-Fusion HD cloning kit (Clontech Laboratories, USA). Targeting vectors were introduced into F1 sporelings of M ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Plant Biology 2024Quote: ... or the SMART-Seq mRNA LP Kit (Takara Bio USA) (for pre-parasitic J2 library generation) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... SYBR RT-PCR Kit was purchased from Takara (Dalian, China). PHrodo-labelled E ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cell Biology 2024Quote: ... and protein concentration was estimated by BCA Kit (Takara-#T9300A). For the assay ...
-
bioRxiv - Physiology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Immunology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Developmental Biology 2024Quote: ... the SMART-seq v4 Ultra Low Input RNA kit (Takara) was used to prepare cDNAs starting from 1.5 µg of total RNA for each sample and sequencing libraries were prepared subsequently prepared using the Ovation Ultralow System V2 (NuGen) ...
-
bioRxiv - Bioengineering 2024Quote: ... AAV was purified with the AAVpro Purification Kit (Takara, 6666) according to manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... and RNA extraction kit were bought from Takara (Dalian, China). Ultrapure water was employed throughout the work ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared using SMART-Seq Stranded Kit (Takara Bio). The quality ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was prepared using PrimeScript cDNA Synthesis Kit (DSS Takara Bio India Pvt ...
-
bioRxiv - Cell Biology 2024Quote: ... using In-Fusion® HD Cloning Kit (Takara Bio, #639650). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... and reverse transcribed using the PrimeScript RT reagent Kit (TaKaRa). qPCR was performed using the SYBR Green Master Mix (High ROX Premixed ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted using the NucleoBond HMW DNA kit (Takara) per the manufacturer’s instructions with a 50 °C proteinase K incubation for 4.5 hours ...
-
bioRxiv - Microbiology 2023Quote: ... After transcribing using the In vitro Transcription T7 Kit (TaKaRa), BHK-21 cells were cotransfected with both full-length genomic and nucleoprotein gene RNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the SYBR Premix Ex Taq kit (Takara, Shiga, Japan) was used as the reaction solution ...
-
bioRxiv - Biochemistry 2022Quote: ... restriction enzymes and DNA ligation kit ver.2 (Takara Bio); pET21a and E ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and pLL3.7m plasmids using CalPhos mammalian transfection kit (Takara Bio). Two days following transfection ...