Labshake search
Citations for Takara Bio :
851 - 900 of 2288 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Aliquots of 1 Mio cells in 1 ml medium were grown overnight in 12-or 24-well plates (either TC-treated or coated with 5 μg/cm2 retronectin [Takara Bio]) and then transduced with VSV-pseudotyped lentivirus encoding for either the 1G4 or the A6 TCR ...
-
bioRxiv - Plant Biology 2021Quote: ... were mixed in a binding buffer (20 μL) containing 5 μL of 10×CutSmart® buffer and 1μL of RNase inhibitor (40U, Takara, Japan) and left for 10 min at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... the nucleus pellet was washed with 5 mL Nuclei Suspension Buffer (NSB; consisting of 1x PBS, 0.01% BSA and 0.1% RNAse inhibitor (Clontech, Catalog no.2313A)) ...
-
bioRxiv - Immunology 2021Quote: ... The first stand cDNA template was synthesized using the 5′ reagents of the Smarter™ RACE cDNA Amplification Kit (Takara USA), following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: The sequences of the A01 and A05 TCR were determined by a previously described 5’-rapid amplification of cDNA ends (5’RACE) based cloning strategy based on the manufacturer’s instructions (Yu et al., 2018; Jing et al., 2017) (Takara Bio, Japan). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... supernatant was removed and the nucleus pellet was washed with 5 ml nuclei suspension buffer (NSB; consisting of 1X PBS, 0.01% BSA and 0.1% RNase inhibitor (Clontech, cat. no. 2313A)) ...
-
bioRxiv - Microbiology 2023Quote: ... lytic-induced or uninduced cells (5×105 cells on a 6-well plate) were harvested with 500 μL of RNAiso Plus (Takara Bio). Total RNA was extracted ...
-
bioRxiv - Cell Biology 2023Quote: RACE-ready (Rapid Amplification of cDNA 5’ Ends) cDNA was generated using SMARTer PCR cDNA Synthesis Kit (#634925, Clontech Laboratories, Inc.) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2023Quote: ... as previously described (17): pcDNA3.1+-based plasmids used for ectopic expression and pRetroX-tight-Puro-based ones (Clontech, cat. PT3960-5) used here to generate stable cell lines expressing ISG20 upon induction with doxycycline (dox.) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5′ Rapid amplification of cDNA ends (RACE) was performed using the primer-R5 (Supplemental Table 5S) with the 5′ Full Race Core kit (TAKARA, Japan). The bioinformatics analysis of CcSHMT1 sequences show in Supplemental marterial ...
-
bioRxiv - Biophysics 2023Quote: ... 5’-CTGGAGAATCCCGGTGC-3’ and 5’- GTGTCAGATATATACATCCTGT-3’ and the PCR product was purified using a NucleoSpin Gel and PCR Clean-up Maxi kit (Takara Bio). The sequences of the 147 bp and 177 bp DNA are as follows:
-
bioRxiv - Neuroscience 2023Quote: ... 5 μL of treated RNA was reverse transcribed using oligo d(T) primers (PrimeScript RT Reagent Kit, Takara Bio, Kyoto Japan). Then ...
-
bioRxiv - Molecular Biology 2024Quote: ... fragmented RNA library was mixed with 5 µM of PE2-N6 primer (Supplementary Table S1) and reverse transcribed using PrimeScript RTase (Takara, SD0418) for 60Lmin at 42L°C ...
-
bioRxiv - Genetics 2023Quote: First-strand cDNA was synthesized from 5 μg of total RNA using the PrimeScriptTMII cDNA Synthesis kit from Takara (https://takara.com/). The full-length cDNAs of SUH1 and BC10 were amplified using the Taq LA DNA polymerase PCR kit from Takara (https://takara.com/ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... VH and VL segments were ordered as gene blocks from Integrated DNA Technologies and were cloned into linearized CMV/R backbones with 5× In-Fusion HD Enzyme Premix (Takara Bio).
-
bioRxiv - Plant Biology 2023Quote: ... the correct full-length sequences were determined for the laboratory strains using a SMARTer RACE 5’/3’ kit (Takara, Shiga, Japan). These sequences were aligned by ClustalW ...
-
bioRxiv - Plant Biology 2024Quote: ... the 5 μl samples were used as input into the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio USA) (for parasitic J3 library generation ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting PCR product was cloned between the 3’ and 5’ arms of the Rosa26 targeting vector using In-Fusion cloning (Takara Bio). Plasmid sequence was checked by sequencing ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSFDUET-1-EIF6 plasmid was co-transformed with pG-KJE8 expressing five bacterial chaperones (5-Ch: DnaK-DnaJ-GrpE, GroES, GroEL) or pG-TF2 expressing 3 bacterial chaperones (3-Ch: GroES, GroEL, TF) (Takara Biosciences) in BL21 (DE3 ...
-
bioRxiv - Developmental Biology 2022Quote: ... This amplified fragment was named N-Cad-M and was subcloned into the 5’ side from P2A peptide (ATNFSLLKQAGDVEENPGP) of the pCAG-P2A-H2B-mCherry vector by In-Fusion Cloning (Takara, Japan). To visualize the membrane of cells that express N-Cad-M ...
-
Induction of telomerase in p21-positive cells counteracts capillaries rarefaction in aging mice lungbioRxiv - Molecular Biology 2022Quote: ... The resulting cDNA was diluted 5-20 fold and analyzed by real-time qPCR using the SYBR Green master mix (Takara bio) and 400 nanomolar each of the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... the University of North Carolina at Chapel Hill) (43) and inserted back into pIZ-Msps-GFP digested with SspI(5’) and XhoI(3’) using Infusion ligation (Takara Bio) to create pIZ-Msps (RNAi-resistant)-GFP ...
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid and cloned within exon 4 (between base 43-44) and exon 5 (between base 71-72) of the circ-HDGFRP3 sequence by In-Fusion Cloning Kit (Takara Bio) to obtain the final constructs p-circ-Ex4 and p-circ-Ex5.
-
bioRxiv - Plant Biology 2024Quote: ... The coding sequences (CDS) of the full length and truncated Sr62NLR were cloned into pGADT-7 vector (Clontech, USA, PT3249-5) with the sites EcoRI and BamHI ...
-
bioRxiv - Cancer Biology 2024Quote: ... reverse primer 5-TACCAAACTCTCAATTGCTC-3’) and the presence of small insertions and deletions assessed with the Guide-it Mutation Detection Kit (Takara Bio). The PCR amplicons were then inserted into pGEM vectors using the pGEM-T Easy Vector system (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.3 μM gene-specific forward/reverse primers and 2 μL of diluted cDNA using a thermal cycler Dice (Takara). The reactions were carried out as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.
-
bioRxiv - Microbiology 2021Quote: ... CPER mixtures contained 0.1 pmol of each DNA fragment and 2 µl of PrimeStar GXL DNA polymerase (Takara, Japan) in a total reaction volume of 50 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... The culture was split into two 2-mL cultures of which one was supplemented with 250 nM rapalog (Clontech). Parasite growth was determined via flow cytometry over five days as described above ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was clarified by centrifugation (292,055 g, 60 min, 4°C) and bound to 2 ml of TALON IMAC resin (Clontech) overnight with 10 rpm rotation in the presence of 20 mM imidazole and NaCl added up to 800 mM ...
-
bioRxiv - Cell Biology 2022Quote: ... The yeast was transformed with the indicated plasmids using the Matchmaker™ Yeast Transformation System 2 (Clontech, Cat#: 630439). Two plasmids containing simian virus (SV ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2021Quote: ... His-tagged NTD domain constructs were purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Genetics 2023Quote: ... The transformation process followed the protocol described in the Yeastmaker™ Yeast Transformation System 2 User Manual (Takara Bio), yielding approximately 2 × 106 and 7 × 106 transformants for LE9 and BLX strains ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
A randomized multiplex CRISPRi-Seq approach for the identification of critical combinations of genesbioRxiv - Genetics 2023Quote: ... to OD600 0.2–0.3 with 2–3 mL fresh AYE +Fe +Cys containing 40 ng/mL anhydrous tetracycline (aTC, Clontech 631310). On the third day ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA encoding FLAG-Rhino was cloned into pPB-2× Ty1-Tjen-EGFP-P2A-BlastR51 using In-Fusion cloning (TAKARA), bearing pPB-FLAG-Rhino-Tjen-EGFP-P2A-BlastR ...
-
bioRxiv - Genomics 2024Quote: ... Supernatant containing viral particles was harvested after 2 and 3 days and concentrated 100x using Lenti-X concentrator (Takara) following manufacturers instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... His-TEV tagged protein was captured with Co-TALON resin (Clonetech, Takara Bio USA, 2 mL slurry/liter culture) at 4 ºC for 1 h with constant end-to-end mixing ...
-
bioRxiv - Neuroscience 2024Quote: ... in BrainPhys neuronal media (composed according to Bardy et al. 2015)74 and 2 µg/ml doxycycline (Takara 631311). Three days after plating and ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was incubated for 1 h at room temperature with Odyssey blocking buffer and 0.2 % PBS-T (PBS containing 0.2 % (v/v) Tween-20) with rat anti-HA clone 3F primary antibody (Clontech) at 1:1,000 dilution ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 2.6 x 106 yeast transformants were screened on 2% SD/Gal/Raf/X-P-gal (-Ura/-His/-Trp/-Leu) following the manufacturer’s instructions (Clontech). Direct protein-protein interaction was confirmed by co-transformation of the respective plasmids into the yeast strain AH109 using the Matchmaker GAL4 Two-hybrid System (Clontech) ...