Human Anti NT5E Recombinant Antibody clone Hu101 28 citations for Takara Bio

Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...

High-throughput Evaluation of Epilepsy-associated KCNQ2 Variants Reveals Functional and Pharmacological Heterogeneity

Carlos G. Vanoye, et al., bioRxiv - Neuroscience 2021

Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...

A chronic signaling TGFb zebrafish reporter identifies immune response in melanoma

Haley R. Noonan, et al., bioRxiv - Cancer Biology 2022

Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...

The molecular mechanism and evolutionary divergence of caspase 3/7-regulated gasdermin E activation

Hang Xu, et al., bioRxiv - Evolutionary Biology 2023

Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...

Perinuclear damage from nuclear envelope deterioration elicits stress responses that contribute to LMNA cardiomyopathy

Kunal Sikder, et al., bioRxiv - Cell Biology 2023

Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...

Functional evolutionary convergence of long noncoding RNAs involved in embryonic development

Ane Olazagoitia-Garmendia, et al., bioRxiv - Molecular Biology 2022

Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...

Optimization of an adeno-associated viral vector for epidermal keratinocytes in vitro and in vivo

Qi Shen, et al., bioRxiv - Bioengineering 2024

Quote: ... The human KRT14 enhancer and promoter sequence [13] [14] was amplified using human genomic DNA from HEK293 cells with PrimeSTAR GXL DNA polymerase (Takara Bio Inc., Shiga, Japan). The human KRT16 pseudogene 5 (K16P5 ...

Adhesion to type I collagen fibrous gels induces E- to N-cadherin switching without other EMT-related phenotypes in lung carcinoma cell A549

Hitomi Fujisaki, et al., bioRxiv - Cell Biology 2020

Quote: Mouse monoclonal E-cadherin antibody (HECD-1) was purchased from Takara Bio Inc ...

Novel proteostasis reporter mouse reveals different effects of cytoplasmic and nuclear aggregates on protein quality control in neurons

Sonja Blumenstock, et al., bioRxiv - Neuroscience 2020

Quote: ... The following primary antibodies were used: GFP (JL-8, Clontech, #632381), Tubulin (Covance ...

Neural plate progenitors give rise to both anterior and posterior pituitary cells

Qiyu Chen, et al., bioRxiv - Developmental Biology 2022

Quote: ... and/or mCherry (Living Colors DsRed Polyclonal Antibody #632496, Takara, Japan) after in situ hybridization were carried out as described in (Chen Q et al. ...

Instantaneous visual genotyping and facile site-specific transgenesis via CRISPR-Cas9 and phiC31 integrase

Junyan Ma, et al., bioRxiv - Bioengineering 2022

Quote: ... EGFP was detected using the JL-8 mouse monoclonal antibody (Clontech). For IHC ...

Hedgehog Activity Gradient in Combination with Transcription Network Confers Multiple Hypothalamic Identities

Maho Yamamoto, et al., bioRxiv - Developmental Biology 2022

Quote: ... the following antibodies were used: Rx (rabbit; TaKaRa, #M228; 1:1,000), Nkx2.1 (rabbit ...

The transcription factor ATML1 maintains giant cell identity by inducing synthesis of its own long-chain fatty acid-containing ligands

Batthula Vijaya Lakshmi Vadde, et al., bioRxiv - Plant Biology 2024

Quote: ... We then ran a western blot using the GFP antibody (Takara living colors EGFP monoclonal antibody JL-8 ...

WWOX promotes osteosarcoma development via upregulation of Myc

Rania Akkawi, et al., bioRxiv - Cancer Biology 2023

Quote: ... The antibody used was rabbit polyclonal DsRed (632496; TaKaRa, 1:500).

Signal sequences target enzymes and structural proteins to bacterial microcompartments and are critical for microcompartment formation

Elizabeth R. Johnson, et al., bioRxiv - Synthetic Biology 2024

Quote: ... The membrane was incubated with an α-GFP primary antibody (Takara Bio cat# 632380 ...

Enhancing the Reverse Transcriptase Function in Taq Polymerase via AI-driven Multiparametric Rational Design

Yulia E. Tomilova, et al., bioRxiv - Bioengineering 2024

Quote: This experiment with a monoclonal antibody to Taq pol (Clontech, USA) and a DNA aptamer (Vector-Best ...

CRISPR associated enzymes are mislocalized to the cytoplasm in iPSC-derived neurons resulting in KRAB-specific degradation

Gregory Cajka, Matthew Liu, Ophir Shalem, bioRxiv - Cell Biology 2024

Quote: ... The following primary antibodies were used: Cas9 (Takara, 632607; 1:150), MAP2 (Abcam ...

Zebrafish Polycomb repressive complex-2 critical roles are largely Ezh2- over Ezh1-driven and concentrate during early embryogenesis

Gabriel A. Yette, Scott Stewart, Kryn Stankunas, bioRxiv - Developmental Biology 2021

Quote: ... Samples were incubated with chicken anti-GFP 1:1000 (Aves) and rabbit anti-DsRed 1:500 (Clontech/Takara) antibodies diluted in blocking solution overnight at 4°C ...

Zebrafish Polycomb repressive complex-2 critical roles are largely Ezh2- over Ezh1-driven and concentrate during early embryogenesis

Gabriel A. Yette, Scott Stewart, Kryn Stankunas, bioRxiv - Developmental Biology 2021

Quote: ... Samples were incubated with chicken anti-GFP 1:1000 (Aves) and rabbit anti-DsRed 1:500 (Clontech/Takara) antibodies diluted in blocking solution overnight at 4°C ...

Interaction between spike protein of SARS-CoV-2 and human virus receptor ACE2 using two-color fluorescence cross-correlation spectroscopy

Ai Fujimoto, et al., bioRxiv - Biophysics 2021

Quote: ... and anti-mCherry (#Z2496N, TaKaRa, Shiga, Japan).

Defining totipotency using criteria of increasing stringency

Eszter Posfai, et al., bioRxiv - Cell Biology 2020

Quote: ... mouse anti-mCherry 1:500 (632543, Clontech); chicken anti-Gfp 1:500 (ab13970 ...

R7 photoreceptor axon targeting depends on the relative levels of lost and found expression in R7 and its synaptic partners

Jessica Douthit, et al., bioRxiv - Developmental Biology 2021

Quote: ... rabbit anti- dsRed (1:500; Takara Bio), guinea pig anti-Loaf (1:400 ...

Labshake search