Labshake search
Citations for Takara Bio :
851 - 900 of 1281 citations for ETS Related Transcription Factor Elf 3 ELF3 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... then imaged after overnight expression and ∼3 hour incubation with 500 nM A/C heterodimerizer linker drug (Takara, 635055) or 100% ethanol ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagged proteins were bound to 6 (=3 mL bed volume) or 3 mL (=1.5 mL bed volume) pre-equilibrated Talon SuperFlow Metal Affinity Resin from TaKaRa (LarA wt ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant adenovirus vaccines were produced using the Adeno-X™ Adenoviral System 3 according to the manufacturer’s manual (Takara Korea Biomedical Inc. ...
-
bioRxiv - Microbiology 2022Quote: ... and the 3’ flanking region) and the linearized pHIS906 were fused using the In-Fusion enzyme (TAKARA, Shiga, Japan) to create the pHIS3-AWP1 plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... filtered through a 0.45 µm polyethersulfone filter and used directly or concentrated 3-fold with Lenti-X Concentrator (Clontech).
-
bioRxiv - Neuroscience 2024Quote: ... AAV was purified 3–5 days after transfection using AAVpro Purification Kit Midi or Maxi (Takara Bio, Shiga, Japan). The viral concentration was measured by qRT-PCR.
-
bioRxiv - Genomics 2024Quote: ... Supernatant containing viral particles was harvested after 2 and 3 days and concentrated 100x using Lenti-X concentrator (Takara) following manufacturers instructions.
-
A randomized multiplex CRISPRi-Seq approach for the identification of critical combinations of genesbioRxiv - Genetics 2023Quote: ... to OD600 0.2–0.3 with 2–3 mL fresh AYE +Fe +Cys containing 40 ng/mL anhydrous tetracycline (aTC, Clontech 631310). On the third day ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... The plasmid for mCherry insertion was constructed with 1.5 kb long 5’ and 3’ arms amplified from the C57BL/6N genome using PrimeSTAR GXL DNA Polymerase (TaKaRa). The 5’ arm is the genomic sequence upstream of the stop codon of Rtl9 and the 3’ arm is downstream of the predictive Cas9 cut site ...
-
bioRxiv - Plant Biology 2023Quote: ... and SD4 (-Trp-Leu-His-Ade) media at 30℃ for 3–5 d according to the manufacturer’s manual (Clontech).
-
bioRxiv - Biophysics 2024Quote: ... to reduce the detergent concentration and incubated for 3 h with 10 mL Talon metal affinity resin (Takara Biotech) pre-equilibrated with buffer S supplemented with 0.1% β-DDM and 0.02% CHS ...
-
bioRxiv - Immunology 2024Quote: ... sfGFP-3×P3-DsRed and homology arms were PCR-amplified using PrimeSTAR® Max DNA Polymerase (Takara Bio, R045). Primers for PCR were designed using the NEBuilder Assembly Tool ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was annealed to an oligo-dT primer (5’-AAGCAGTGGTATCAACGCAGAGTACT30VN-3’, IDT) in a buffer containing 2.5 mM dNTPs and recombinant RNase Inhibitor (Takara). First-strand synthesis was performed with the SuperScriptII kit using a custom template-switching oligo (5’-/5Me-isodC//iisodG//iMe-isodC/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3’ ...
-
bioRxiv - Developmental Biology 2024Quote: ... The HRT for attaching GFP at the 3’ end of pan-1 was made by PCR (Takara PrimeStar Max) from plasmid pPD95.75 (Addene #1494 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse monoclonal antibody against EGFP (Clontech, Mountain View, CA) was used for western blotting at a dilution of 1:1,000 and rabbit polyclonal antiserum reactive against protein kinase A (PKA ...
-
bioRxiv - Neuroscience 2021Quote: ... or monoclonal mouse anti-GFP antibody (1:1000, Clontech). Membranes were then washed and incubated with horseradish peroxidase-conjugated anti-chicken ...
-
bioRxiv - Developmental Biology 2021Quote: ... stained with anti-GFP antibody (1/800, 632592, Clontech) and biotinylated anti-rabbit IgG (1/200 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 9 µl anti-c-Myc Monoclonal antibody (Clontech/Takara) were added to each sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... 9 µl anti-c-Myc Monoclonal antibody (Clontech/Takara) were added to each sample ...
-
bioRxiv - Cell Biology 2021Quote: ... Antibodies against RFP and GFP were obtained from Clontech and Life Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-STEM101 antibody (Takara Bio Inc., 1:100) to stain for transplanted human NPCs ...
-
bioRxiv - Cell Biology 2022Quote: Primary antibodies against GFP (Clontech, JL-8; 1:5000), G-6-PDH (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies against mCherry (Mouse, Clontech, 632543; 1/500), GFP (rabbit polyclonal anti-GFP ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-DsRed antibody (Clontech, 632496, 1:100 dilution), Guinea pig anti-Period antibody (Gift from Amita Sehgal ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated with primary antibodies against GFP (Clontech, 632381), HA (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... mouse monoclonal antibody against EGFP (Clontech, Mountain View, CA) was used for Western blotting at a dilution of 1:1,000 ...
-
bioRxiv - Pathology 2022Quote: ... Primary antibodies: rabbit anti-DsRed express (Clontech, 1:250) and goat anti-HRP (Jackson Lab ...
-
bioRxiv - Biophysics 2024Quote: ... and blotted with anti-GFP/YFP antibody (mouse, Clontech) at 1:5000 dilution overnight at 4° C on a rocking platform ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DSred primary antibody 1:500 (Takara, 632496) which binds Td-tomato protein ...
-
bioRxiv - Microbiology 2023Quote: ... living colors antibody was purchase from Clontech (Cat# 632381). The Alexa Fluor 568 goat anti-mouse IgG H+L antibody was purchased from ThermoFisher (Cat# A11004) ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibody Rabbit-anti-DsRed (Clontech #632496, 1:1000) and secondary antibody HRP-goat-anti-rabbit (1:500 ...
-
bioRxiv - Cell Biology 2024Quote: ... The rabbit polyclonal antibody against GFP was from Takara Bio Inc (Catalog number ...
-
bioRxiv - Cell Biology 2020Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′-GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... Specific forward and reverse primers (Suppl Table 3) were designed using the In-Fusion Cloning Primer Design Tool from TaKaRa (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting plasmids were co-transformed into Saccharomyces cerevisiae strain AH109 according to the protocols in the Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The yeast cells were cultured on SD/-Leu-Trp (-LW ...
-
bioRxiv - Molecular Biology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [18] (ii ...
-
bioRxiv - Pathology 2020Quote: ... The PCR assay was conducted as described previously9 and the complete genome termini was determined using the Takara SMARTer RACE 5’/3’ kit (TaKaRa) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... CPER fragments containing WT or mutated or 3’UTRs were amplified from the plasmids using PrimeStar GXL polymerase (Takara, Japan) and gel-purified ...
-
bioRxiv - Plant Biology 2020Quote: ... The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196) and Atcox1-3’(+17..+38) using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4 minute-denaturation at 95°C ...
-
bioRxiv - Microbiology 2021Quote: Evaluation of protein interactions by the GAL4-based Y2H system was performed by following the manufacturer’s recommendations for the Matchmaker GAL4 Two-hybrid System 3 (Clontech, USA). Competent AH109 yeast cells (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [3] ...
-
bioRxiv - Microbiology 2020Quote: ... was co-transformed with different bait-prey combinations as indicated in Extended Data Fig.1 in accordance with instructions for Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The transformed yeast was then screened in 4-dropout plates for the protein-protein interaction.
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Biophysics 2020Quote: Target DNA containing the 5′-TTTA-3′ PAM was ordered from IDT and cloned into a pET28-MHL vector using the In-Fusion Cloning Kit (ClonTech). Plasmids were linearized before usage ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCRs (sqPCRs) were performed on 3 μl of cDNA template using Emerald Amp Max PCR Master Mix (Takara). The sequences of the primers used for PCR amplifications are included in Supplemental Table 4.
-
bioRxiv - Plant Biology 2022Quote: ... and pMKMM21 (3.5 kb upstream SYP12A:5’UTR:miniTurbo- Myc-SYP12A:3’UTR) were generated by in-fusion cloning (HD enzyme mix; Takara Bio). Gateway binary vectors pMKMM22 and pMKMM23 for the expression of miniTurbo-Myc- MpSYP13B and miniTurbo-Myc-MpSYP12A were generated by LR-recombination (LR clonase ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... cerevisiae strains used for yeast two-hybrid analysis were Y187 (MATα, ura3-52, his3-200, ade2-101, trp1-901, leu2-3, 112, gal4Δ, met–, gal80Δ, URA3::GAL1UAS-GAL1TATA-lacZ; Clontech) and Y2H Gold (MATa ...