Labshake search
Citations for Takara Bio :
851 - 900 of 1416 citations for 7 Bromo 6 chloro 3 3 3 hydroxy 2 piperidyl 2 oxopropyl quinazolin 4 3H one monohydrobromide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: SseI gene was amplified from Salmonella typhimurium (STM) strain LT-2 strain using high fidelity DNA polymerase enzyme from TaKaRa and cloned in with N-terminal flag and HA tag in mammalian expression vector pcDNA3 flag HA Akt1 plasmid obtained from addgene(1477) ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... A total of 3.5 μl ribo-depleted material was used for SMARTer (SMARTer PCR cDNA Synthesis Kit, catalog num. 634926 and Advantage 2 PCR kit, catalog num. 639207, Clontech-Takara) protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Clarified lysate was then filtered through a 0.45 µm syringe filter and mixed with 2 mL of washed TALON® Metal Affinity Resin beads (Takara). The mixture was allowed to bind under nutation at 4℃ for 1 hr ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... was used as a template to generate the pCMV-myc-SFPQ ΔRRM1-2 by mutagenesis using the InFusion HD kit from Clontech (catalog number 639649 ...
-
bioRxiv - Genetics 2023Quote: ... cDNA was generated from 2 ng of RNA using the Smart-Sq V4 Ultra Low Input RNA Kit (Takara, 634894). Next ...
-
bioRxiv - Genomics 2023Quote: ... The transfected cells were cultured for 2 days and lentivirus were harvested and concentrated using the Lenti-X concentrator (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... and cDNA was synthesized with 2 μg RNA using PrimeScript™ 1st strand cDNA synthesis kit (TaKaRa, Kusatsu, Shiga, Japan) in a final reaction volume of 20 μl following the manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... and GC B cells (live singlet CD19+ CD4− IgDlo CD71+CD38int CD20+ CXCR5+) were sorted using a FACSAria II into 96-well plates containing 2 μL Lysis Buffer (Clontech) supplemented with 1 U μl−1 RNase inhibitor (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... Titration of the concentrated viruses was performed by AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc) following the manufacture’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: The dCas9-KRAB-NLS-NLS sequence was amplified from the plasmid PB-TRE-dCas9-KRAB-MeCP2 (Tan, 2022) (addgene 122267) using PrimeSTAR Max 2 ×premix (Takara). A T7 promoter sequence was included in forward primer for in vitro transcription using the mMESSAGE mMACHINE T7 Ultra Transcription kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... The upstream and downstream regions adjacent to the binding site were amplified using Advantage 2 polymerase (Takara Bio, Shiga, Japan) from 3T3-L1 genomic DNA and cloned into the HR110-PA-1 vector (System Biosciences) ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized using a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara).
-
bioRxiv - Plant Biology 2024Quote: ... The genomic DNA sequences surrounding the potential off-target sites selected for further analysis (Table 2) were amplified by PCR using specific primers (Supplementary Table S1) and PrimeSTAR GXL DNA Polymerase (Takara) from CRISPR/Cas-edited hairy roots (R1 of E-CP1 [the main root and five lateral roots] ...
-
bioRxiv - Cell Biology 2023Quote: HeLa cells and hippocampal neurons were transfected with plasmids encoding FM4 recombinant receptors for 15 h and then treated with 2 μM DD-Solubilizer (TakaraBio/Clontech) to induce the release of the receptors from the ER into the secretory trafficking ...
-
bioRxiv - Microbiology 2024Quote: Each individual SARS-CoV-2 fragment was amplified from their respective plasmids using an exclusive pair of primers (Supplementary Table 2) and high-fidelity PrimeSTAR GXL DNA polymerase (Takara), followed by gel isolation with NucleoSpin Gel and PCR Clean-up (Macherey-Nagel ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids expressing HuSaV (GI.2) and PSaV protease-polymerase fusion were generated by cloning into the XhoI and BamHI sites of pmCherry-C1 (Clontech). Vectors expressing RIG-I-CARD domain [25] and IRF3-5D [26] were previously described ...
-
bioRxiv - Microbiology 2024Quote: ... individual FLAG-HA tagged Vpr genes were amplified from the pLRGatewayIRESeYFP-Vpr plasmids using the primers in Table 2 and subcloned into pLVX-TetOne-puro (Clontech) using EcoRI and BamHI restriction sites ...
-
bioRxiv - Microbiology 2024Quote: ... Y453F and T76G were inserted in plasmid F5 or F1 respectively by Directed Site Mutagenesis using the primers (Supplementary Table 2) and high-fidelity PrimeSTAR GXL DNA polymerase (Takara).
-
bioRxiv - Neuroscience 2023Quote: Mammalian expression constructs were mainly generated by Gibson assembly of PCR-amplified coding sequences (primers, Supp. Data File 2) into restriction-digested pC1 (CMV promoter, modified from pEGFP-C1, Clontech) or pCAG (CMV enhancer fused to chicken beta-actin promoter ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Physiology 2023Quote: For Matchmaker Gold yeast one-hybrid system (Clontech, Mountain View, CA, USA), the MaMYB4 CDS was fused to the GAL4 transcription factor activation domain (GAL4AD ...
-
bioRxiv - Plant Biology 2021Quote: Yeast strain AH109 was transformed with bait (pGBKT7) and prey (pGADT7) constructs by following the small scale yeast transformation protocol from Yeastmaker™ Yeast Transformation System 2 (Clontech). Upon transformation ...
-
bioRxiv - Genomics 2020Quote: ... and the resulting DNase I-treated RNA (~2 ng) was processed for sequencing by using a SMART-Seq v4 Ultra Low Input RNA kit (Takara Bio) according to the manufacturer’s protocol with 12 cycles of PCR followed by two rounds of clean up with 1.3X Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The first stranded cDNA was next amplified to produce double stranded cDNA in 20 amplification cycles by long distance PCR using the Advantage 2 polymerase mix (Takara, Clontech) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: For the V1 protocol 20 µL of pooled and ExoI treated cDNA was PCR amplified with Advantage 2 Polymerase Mix (Clontech, #639206) in 50 µL total reaction volume using 1 µL of 10 µM LA_oligo (Microsynth ...
-
bioRxiv - Genomics 2020Quote: ... PCRs were performed on board using 25 ng of DNA from each coral sample with the Advantage 2 kit (Takara Clontech) and a final primer concentration of 0.5 μM in a final reaction volume of 50 μl ...
-
bioRxiv - Genomics 2021Quote: ... were used for library construction using the SMARTer Stranded Total RNA-Seq Kit v.2 (634418, Pico Input Mammalian, Takara/Clontech, Japan) according to the manufacturer’s protocol without RNA fragmentation ...
-
bioRxiv - Genomics 2020Quote: ... 2 μg of total RNA per sample was used to generate first-strand cDNA using reverse transcription system (Takara, Dalian, China). Quantitative RT-PCR was performed using SYBR Premix Ex Taq (Takara ...
-
bioRxiv - Immunology 2021Quote: ... Single stranded cDNA was synthesized immediately by adding 0.7 µl SMARTScribe reverse transcriptase (100 U/µl, f/c 2 U/µl, Takara Bio #639537), 7 µl First-Strand buffer (f/c 1×) ...
-
bioRxiv - Bioengineering 2020Quote: ... The lysate was loaded onto a prepared column with 2 mL TALON Metal Affinity Resin (Clontech Laboratories, Inc., Mountain View, CA). After being washed twice with 5 column volumes (CV ...
-
bioRxiv - Systems Biology 2020Quote: ... proteins in whole cell extract and immunoprecipitated fractions were digested with 2 mg/mL proteinase K (Takara Bio Inc., Kusatsu, Japan) at 42°C for 2 h ...
-
bioRxiv - Cell Biology 2021Quote: γ2 mCherry and tethered GluA2 (flop isoform)::γ260 were subcloned into the doxycycline-inducible expression vector pBI-Tet (Clontech, #6152-1) using the restriction sites MluI/XbaI and MluI/NheI ...
-
bioRxiv - Cancer Biology 2021Quote: We quantified mRNA expression levels of IL-10 and chemokines identified in the RNA-Seq analysis using 2-step real-time RT-PCR (Thermal Cycler Dice Real Time System, Takara Bio). The ribosomal protein L13a (RPL13A ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were transfected with plasmids expressing either SARS-COV-2 S protein WT or mutants (E1182K, L1193G, E1182K/L1193G, L1182K/L1186G/L1193G) by using Calcium phosphate transfection kit (Takara-Bio). 24 h post transfection ...
-
bioRxiv - Microbiology 2021Quote: ... The copy number of viral RNA was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, cat# RC300A). The fluorescent signal was acquired using a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... whereas a TOPBP1 fragment corresponding to residues 2-1523 was amplified from pCDNA5-FRT/TO-LacR-FLAG-TopBP1 and cloned into pGBKT7 (Clontech/Takara) to create a fusion with the GAL4 DNA binding domain using the NdeI and XmaI sites ...
-
bioRxiv - Genetics 2019Quote: ... The pure linearized vector and the elpc-2 promoter were fused using an In-Fusion HD Cloning Kit (Takara, Kusatsu, Japan) to make the elpc-2p::GFP transcriptional reporter construct ...
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μl sense and 1 μl anti-sense primers of 100 μM each were mixed with 2 μl 10X Taq polymerase PCR buffer (Takara, Japan) and 16 μl ultra-pure water to a final volume of 20 μl ...
-
bioRxiv - Molecular Biology 2019Quote: ... with a universally tailed poly-dT primer and a template switching oligo followed by amplification for 12 cycles with the Advantage 2 DNA Polymerase (Takara Bio). After ultrasonic shearing (Covaris LE220) ...
-
bioRxiv - Immunology 2021Quote: ... was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio). pSFG-SARS-CoV-2 S D614G was cloned from pSFG-SARS-CoV-2 S plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs) ...
-
bioRxiv - Microbiology 2021Quote: ... real-time RT-PCR was performed with SARS-CoV-2 N primer sets and SYBR Premix Ex Taq II (TaKaRa-Bio) using a LightCycler Nano (Roche ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR reactions were performed in a 25μl-reaction mixture containing 12.5μl of 2 × Gflex PCR Buffer (Mg2+, dNTP plus) (TaKaRa Bio Inc., Shiga, Japan), 0.5μl of Tks