Labshake search
Citations for Takara Bio :
851 - 900 of 2145 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and 90 μl of DNase I (1 U/μl) (TAKARA, Japan). The suspension was thoroughly re-suspended ...
-
bioRxiv - Cell Biology 2023Quote: ... The supernatant was incubated with 1 ml NiNTA Superflow resin (Takara) overnight rotating at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... tissues were stained using rabbit anti-dsRed (1:1000, #632496, Clontech) and mouse nc82 (1:30 ...
-
bioRxiv - Cancer Biology 2023Quote: ... to 7.5μL eluted RNA 2.5μL smRNA mix 1 (Takara Cat. #635031) and 1μL 10uM UMI RT primer (seq ...
-
bioRxiv - Cancer Biology 2023Quote: ... The antibody used was rabbit polyclonal DsRed (632496; TaKaRa, 1:500).
-
bioRxiv - Developmental Biology 2022Quote: ... the following antibodies were used: Rx (rabbit; TaKaRa, #M228; 1:1,000), Nkx2.1 (rabbit ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-dsRed: (1:5000, Takara Bio, Clontech, Australia, Cat#: 632496), goat anti-mCherry (1:5000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-dsRed: (1:5000, Takara Bio, Clontech, Australia, Cat#: 632496), goat anti-mCherry (1:5000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies used were rabbit anti-DsRed (1:500; #632496, Takara), rat anti-mCherry (1:1000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each reaction received 1 unit Titanium Taq polymerase (TaKaRa cat. #: 638517). All steps prior to amplification were performed RNase-free ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 million Lenti-X HEK293T cells (Takara Bio, cat. no. 632180) were seeded in 2 mL DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... retroviral supernatant was added onto retronectin-coated (1:25; #T100B TaKaRa) non-tissue culture treated plates and centrifuged at 2000 ×g for 60 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Tet-On Inducible Expression System® plasmid (Clontech, Cat.No. 1. 634301) was linearized by digestion with EcoRI and AgeI ...
-
bioRxiv - Genetics 2024Quote: ... and 1 U TaKaRa LA Taq (Takara Bio Inc., Kyoto, Japan) was prepared ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP (Living Colors, Takara Biotech, San Jose CA, 632375; 1:2000), Pfn1 (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... the primary antibodies (anti-DsRed in rabbit 1:1000 (632496, Takara); anti-GFP in chicken 1:1000 (13970 ...
-
bioRxiv - Genomics 2024Quote: ... TALON® Metal Affinity Resin (1 mL) (Takara Biosciences, catalog # 635504) was equilibrated with Lysis Buffer ...
-
bioRxiv - Immunology 2024Quote: ... was synthesized by GenScript (Piscataway NJ) and subcloned in a pLVX-IRES-zsGreen 1 (Takara Bio ...
-
bioRxiv - Plant Biology 2024Quote: ... following in the Yeast User Manual PT4087-1 (Clontech, Shiga, Japan). The CDSs of the corresponding TFs NbMYB42 and NbARF18La/b were cloned into the pGADT7 vector ...
-
bioRxiv - Genetics 2024Quote: ... and 1 μL of T4 Polynucleotide Kinase (10 U/μL; TAKARA) were added ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used: Cas9 (Takara, 632607; 1:150), MAP2 (Abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal GFP (JL-8, 632381, 1:2000 for immunoblotting, Clontech); Alexa Fluor-488- ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Biochemistry 2023Quote: ... ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Biophysics 2024Quote: ... for 35 min at 4°C and the supernatant was incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Purification Buffer and 10 column volumes of Purification Buffer with 10 mM imidazole before elution using Purification Buffer with 300 mM imidazole ...
-
bioRxiv - Microbiology 2024Quote: ... After co-cultivation, the organoids were collected and resuspended in 4% paraformaldehyde (PFA, Servicebio, China) at 4 [or RNAiso Plus (Takara, Japan) at −80□ for further analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Immunology 2024Quote: ... SMARTScribe reverse transcriptase (5 U/uL, Takara), Template-Switching Oligo (TSO ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM DTT and 400 units/ml of Recombinant RNase Inhibitor (TaKaRa)) with cOmplete (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... the enhanced yellow fluorescent protein (YFP) from pEYFP-N1 (#6006-1, Clontech), the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 μl lysis buffer per well (1:20 RNase inhibitor (Clontech) in 0.2% (v/v ...
-
bioRxiv - Neuroscience 2021Quote: ... the primary antibody rabbit anti-dsRed (Takara Bio, Cat# 632496, 1:500) and the secondary antibody goat anti-rabbit ...
-
bioRxiv - Cell Biology 2021Quote: Purified proteins or polymers were diluted using 1× PBS (Takara Bio, T900), and loaded into custom-made microneedles prepared with the P1000IVF micropipette puller (Sutter Instrument) ...
-
bioRxiv - Microbiology 2020Quote: Total RNA from 1×106 K562 cells were extracted using Trizol (Takara) and purified with Qiagen RNAeasy mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... then primary staining for mCherry (rabbit anti-DsRed, 632393, Clontech, 1:300) and secondary staining (goat anti-rabbit Ig Cy3 ...
-
bioRxiv - Cell Biology 2022Quote: ... and a pAb anti-GFP (632592, WB: 1/1000) was from Takara. All secondary Abs for immunofluorescence (IF ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:1,000 for rabbit anti-DsRed (Takara Bio USA #632496, RRID: AB_10013483)) were applied to the samples at 4°C for 2 days ...
-
bioRxiv - Cancer Biology 2021Quote: ... relative cell mass was assessed using WST-1 Cell Proliferation Reagent (Clontech) per manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DSRed antibody (Living Colours; Clontech; Cat# 632496, dilution 1:300), rabbit anti-red fluorescent protein (RFP ...
-
bioRxiv - Neuroscience 2021Quote: ... and/or anti-DsRed (host: rabbit, 1/500, #632496 Takara Bio Clontech). Slices were then rinsed three times in PBS (10 min each ...
-
bioRxiv - Neuroscience 2021Quote: ... and/or anti-DsRed (host: rabbit, 1/500, #632496 Takara Bio Clontech). Slices were then rinsed three times in PBS (10 min each ...