Labshake search
Citations for Takara Bio :
851 - 900 of 2536 citations for 2 Chloro 1 1 trifluoromethyl 1 3 4 9 tetrahydro 2H beta carbolin 2 yl ethan 1 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... and 0.5 μL Advantage 2 DNA Polymerase (Takara). Thermocycling conditions were as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 2 µg/ml doxycycline (Clontech, 631311) for 3 days prior to electroporation and to induce Cas9 nickase expression ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μL of T7 Enzyme Mix (TaKaRa). This was adjusted to 30 μL with nuclease-free ddH2O before incubating the mixture at 42°C for 2 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 ul recombinant RNase inhibitor (Takara, 2313B). Isolated nuclei were sorted on a MA900 Multi-Application Cell Sorter (Sony Biotechnology) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μl of cloning enhancer (Takara-bio Inc.) was added to 5 μl of PCR reaction volume to remove the original plasmid ...
-
bioRxiv - Plant Biology 2022Quote: ... using Yeastmaker™ Yeast Transformation System 2 (Clontech). Transformants were grown on minimal synthetic defined (SD ...
-
bioRxiv - Immunology 2023Quote: ... Kit Advantage 2 PCR Enzyme System (Clontech, 639206), QIAquick Gel Extraction ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of PrimeSTAR GXL DNA polymerase (Takara), 200 uM of each dNTP ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μg/ml doxycycline (Clontech, cat. no. 631311), 1X N2 supplement (Life Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 μg/ml doxycycline (Clontech, cat. no. 631311), 1X N2 supplement (Life Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µg/mL doxycycline (Clontech; Cat. No. 631311), and 50 nM TMP (MP Biomedical ...
-
bioRxiv - Microbiology 2024Quote: ... 2 U/µl of Ribonuclease Inhibitor (Takara Inc), 20 ng/µl of plasmid DNA ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Microbiology 2024Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C in a vertical rotating mixer (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... a beta-galactosidase staining kit (Takara-bio, Shiga, Japan) was used according to the provider’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using a PrimeScript RT reagent kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA (1:10 diluted) was mixed with target-specific primers and SYBR Green Supermix (Takara). Data analysis was done using Viia7 sequence detection interface (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... beads were resuspended with 27 µl ddH2O and 1 µl 10× Ex-Taq buffer (TaKaRa). 1 µl proteinase K (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: The following antibodies were used for western blotting: mouse anti-GFP (1:5000; Clontech 632381), rabbit anti-Vinculin (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody used for western blotting (WB) was anti-GFP (Clontech #632592, dilution 1:1000). Secondary conjugated antibodies used for western blotting were Beta Actin HRP conjugated antibody (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were resuspended in 500uL FACS buffer with RNase inhibitor (Takara Bio 2313B, 1:500) and 0.5ul Propidium Iodide (ThermoFisher Scientific P3566 ...
-
bioRxiv - Neuroscience 2021Quote: ... Total RNA (1 µg) was reverse-transcribed with PrimerScript™ RT Master Mix (Takara, #RR047A) after DNase I treatment (Takara ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Neuroscience 2021Quote: ... The coding region of rGAT-1 was inserted into pEYFP-C1 (Clontech, Palo Alto, CA). QuikChange Site-directed Mutagenesis kit was utilized to introduce the GAT-1 variants into a wildtype GAT-1 plasmid ...
-
bioRxiv - Biophysics 2020Quote: ... and allowed to bind to cobalt resin (Talon, Clontech; 1 mL bed volume/L culture). The column was washed sequentially with cobalt wash buffer (CoWB ...
-
bioRxiv - Biophysics 2022Quote: HIV-1 Gag (75) was ligated into pEGFP-N1 (Clontech, Takara Bio, Mountain View, CA) to generate the HIV-1 Gag-EGFP vector ...
-
bioRxiv - Biophysics 2022Quote: HIV-1 Gag (75) was ligated into pEGFP-N1 (Clontech, Takara Bio, Mountain View, CA) to generate the HIV-1 Gag-EGFP vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the primers listed in Table 1 with the In-Fusion HD cloning system (Takara). To silence GSK3B expression ...
-
bioRxiv - Biochemistry 2020Quote: ... tricornutum genomic DNA using primers described in Table 1 (Supplemental Information) and Primestar polymerase (Takara) with primers LYS13-LYS16 ...
-
bioRxiv - Biochemistry 2020Quote: ... and the supernatant was mixed with 1 mL of TALON® metal affinity beads (Clontech) previously equilibrated with equilibration buffer (PBS pH 8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA (1 μg) was reverse transcribed by a reverse transcription kit (RR047A, Takara, China). Real-time quantitative PCR was performed on ABI 7500 system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Microbiology 2020Quote: The HSV-1 copy number was examined by qPCR using SYBR/ROX (RR82LR; Takara, Japan) on ABI qPCR machine (Lifetech ...
-
bioRxiv - Microbiology 2021Quote: ... protein expression was induced with 1 mM of isopropyl-β-D-thiogalactopyranoside (IPTG; Takara Bio) at the final concentration at 25°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Permeabilized cells were then mock treated or treated with 1 mg/ml RNase A (Takara) diluted in PBS for 20 minutes at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... rDA1m was immunostained using a rabbit anti-RFP antibody (1:1000, Takara, cat. number 632496) followed by a Cy3-conjugated donkey anti-rabbit secondary antibody (1:1000 ...
-
bioRxiv - Genomics 2020Quote: ... in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766, Clontech) to maximise the number of individual transformants (800,000 individual clones) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the final volume was increased to 1 mL using SOC medium (cat. no. ST0215, Takara) pre-warmed to 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 150 mM NaCl and 1 mM DTT]23 or CellAmp Processing Buffer (TaKaRa, Kusatsu, Japan) or Lysis Solution of SuperPrep (TOYOBO ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 μg was reverse-transcribed using PrimeScriptTM RT Reagent Kit (perfect Real Time) (Takara). RT-qPCR was performed with qPCRBIO SyGreen Mix LoRox polymerase (Cultek ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSF-DUET-1-EIF6 construct was used to express eIF6 and the pTf16 (Takara Biosciences) construct was used to express the TF chaperone ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR products and pGEX6P-1 vector were digested with EcoRI (Takara Bio, Shiga, Japan) and NotI (Takara Bio ...
-
bioRxiv - Plant Biology 2022Quote: ... eGFP was immuno detected with anti-GFP antibody (1:4000 dilution) (JL-8, #632380, Takara) and anti- mouse-HRP (1:15000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... was amplified using following primer pairs (AtEH1_1-527_GBD_F GCCATGGAGGCCGAATTCCCAATGGCGGGTCAGAATCCTAACATGG and AtEH1_1-527_GBD_R CTGCAGGTCGACGGATCCCCTTATGCAGAATATCCATT ACCTAGGTGATTAGC) and cloned into the pGBKT7 vector (Clontech). The cytoplasmic part of CLV1 (AA 671 to 980 ...
-
bioRxiv - Neuroscience 2024Quote: ... and resuspended in PBS with 0.3%BSA and 1% recombinant RNase inhibitor (RRI, Takara Bio). Next ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA libraries were then synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech; PT4097-1) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were treated with 200 ng ml−1 of Dox (#631311; TaKaRa, Kusatsu, Japan) for 24 h ...