Labshake search
Citations for Takara Bio :
851 - 900 of 2428 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-dsRed: (1:5000, Takara Bio, Clontech, Australia, Cat#: 632496), goat anti-mCherry (1:5000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies used were rabbit anti-DsRed (1:500; #632496, Takara), rat anti-mCherry (1:1000 ...
-
bioRxiv - Microbiology 2024Quote: ... and 90 μl of DNase I (1 U/μl) (TAKARA, Japan). The suspension was thoroughly re-suspended ...
-
bioRxiv - Systems Biology 2022Quote: ... rabbit dsRed (1:500, Clonetech Takara 632496 to detect Tomato protein); mouse βTubulin (1:600 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-mCherry monoclonal antibody (1:500; Takara Bio Cat# 632543), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... or rabbit anti-DsRed (1:2000; Takara Bio Cat# 632496, RRID:AB_10013483) in block at 4°C overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each reaction received 1 unit Titanium Taq polymerase (TaKaRa cat. #: 638517). All steps prior to amplification were performed RNase-free ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 million Lenti-X HEK293T cells (Takara Bio, cat. no. 632180) were seeded in 2 mL DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... retroviral supernatant was added onto retronectin-coated (1:25; #T100B TaKaRa) non-tissue culture treated plates and centrifuged at 2000 ×g for 60 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Tet-On Inducible Expression System® plasmid (Clontech, Cat.No. 1. 634301) was linearized by digestion with EcoRI and AgeI ...
-
bioRxiv - Cancer Biology 2023Quote: ... The transduced cells were selected using puromycin (1 μg/ml; Clontech) for five days ...
-
bioRxiv - Cell Biology 2023Quote: ... The supernatant was incubated with 1 ml NiNTA Superflow resin (Takara) overnight rotating at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... tissues were stained using rabbit anti-dsRed (1:1000, #632496, Clontech) and mouse nc82 (1:30 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The antibody used was rabbit polyclonal DsRed (632496; TaKaRa, 1:500).
-
bioRxiv - Cancer Biology 2023Quote: ... to 7.5μL eluted RNA 2.5μL smRNA mix 1 (Takara Cat. #635031) and 1μL 10uM UMI RT primer (seq ...
-
bioRxiv - Genetics 2024Quote: ... and 1 U TaKaRa LA Taq (Takara Bio Inc., Kyoto, Japan) was prepared ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP (Living Colors, Takara Biotech, San Jose CA, 632375; 1:2000), Pfn1 (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... the primary antibodies (anti-DsRed in rabbit 1:1000 (632496, Takara); anti-GFP in chicken 1:1000 (13970 ...
-
bioRxiv - Plant Biology 2024Quote: ... following in the Yeast User Manual PT4087-1 (Clontech, Shiga, Japan). The CDSs of the corresponding TFs NbMYB42 and NbARF18La/b were cloned into the pGADT7 vector ...
-
bioRxiv - Genomics 2024Quote: ... TALON® Metal Affinity Resin (1 mL) (Takara Biosciences, catalog # 635504) was equilibrated with Lysis Buffer ...
-
bioRxiv - Immunology 2024Quote: ... was synthesized by GenScript (Piscataway NJ) and subcloned in a pLVX-IRES-zsGreen 1 (Takara Bio ...
-
bioRxiv - Genetics 2024Quote: ... and 1 μL of T4 Polynucleotide Kinase (10 U/μL; TAKARA) were added ...
-
bioRxiv - Cell Biology 2024Quote: ... The following primary antibodies were used: Cas9 (Takara, 632607; 1:150), MAP2 (Abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse monoclonal GFP (JL-8, 632381, 1:2000 for immunoblotting, Clontech); Alexa Fluor-488- ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Biochemistry 2023Quote: ... ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Immunology 2024Quote: ... SMARTScribe reverse transcriptase (5 U/uL, Takara), Template-Switching Oligo (TSO ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... Lenti-X concentrator (PT4421-2, Clontech) was mixed at the ratio of 1:3 and incubated at 4 °C for a short time ...
-
bioRxiv - Cell Biology 2021Quote: ... and doxycycline (2 mg/ml, Clontech). After 6 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...
-
bioRxiv - Immunology 2023Quote: ... version 2 (Takara cat. no. 634411) and mRRBS library preparation was performed using custom procedures previously described by our group (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 Units of Exonuclease III (Takara) were added to 1ug of NCPs in ExoIII digestion buffer (50 mM Tris– HCl (pH 8.0) ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Immunology 2024Quote: ... version 2 (Takara cat. no. 634411). After sequencing ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 μg/mL doxycycline (Clontech, 631311), 0.5 mM lysine ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR with Advantage 2 (Takara 639207). 5 µL of ligation sample ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 mM DTT and 400 units/ml of Recombinant RNase Inhibitor (TaKaRa)) with cOmplete (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... the enhanced yellow fluorescent protein (YFP) from pEYFP-N1 (#6006-1, Clontech), the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE ...