Labshake search
Citations for Takara Bio :
851 - 900 of 2397 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Microbiology 2021Quote: ... and NCIMB8826R using the pts1BCA_trunF (5’-TCGTCACCGAGTGTTCGTTT) and pts1BCA_trunR (5’-AGTTGCTGGCCACTGTTCAT) primers (Table S8) and ExTaq DNA polymerase (TaKaRa, Shiga, Japan). Thermal cycling conditions were as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... the promoter pgrd-10 was amplified from fosmid WRM0612bC07 using 5’-ccatgattacgccaatcgtcatc-3’ and 5’-tggccaatcccggggtttttaga-3’ and cloned with Gateway backbone amplified using 5’-ccccgggattggcca-3’ and 5’-ttggcgtaatcatgg-3’ to make pgrd-10∷GW [pNBRGWY151] using infusion cloning(Takara). It was then recombined with ced-10 WT[pNBRGWY88] using LR recombination (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: ... and those targeting the Alu repeat sequence in the nuclear genome (5′-CTTGCAGTGAGCCGAGATT-3′ and 5′- GAGACGGAGTCTCGCTCTGTC-3′) (75) with TB Green Premix Ex Taq II (TaKaRa) on Thermal Cycler Dice Real Time System II (TaKaRa) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2023Quote: ... dsDNAs were amplified by PCR using modified primers with 5’Bioton – 5 x phosphorothioate bonds (synthesized by eurofins) and PrimeSTAR Max (Takara).
-
bioRxiv - Cell Biology 2023Quote: ... was PCR-amplified with the primer set (fwd: 5’- CTTCGAATTCTGGCCACCATGGCTGCCGCCACCACC-3’, rev: 5’- CGGTGGATCCccCAAGAAATCCTTGATGTTAAGATCCGCTAATGG-3’) and inserted into EcoRI and BamHI sites of pmCherry-N1 (Clontech) by restriction digestion and T4 ligation ...
-
bioRxiv - Microbiology 2023Quote: ... The V1-V2 variable region of stool DNA was amplified by universal primer set 27F-mod (5’-AGRGTTTGATYMTGGCTCAG-3’) and 338R (5’-TGCTGCCTCCCGTAGGAGT-3’) using Gflex DNA polymerase (Takara) 37 ...
-
bioRxiv - Molecular Biology 2024Quote: ... synthesized 5’ and 3’ fragments of the target RNA were 32P-radiolabeled at the 5’ end using T4 polynucleotide kinase (Takara). After gel purification ...
-
bioRxiv - Neuroscience 2024Quote: ... Full-length of itga2 was inserted into the Sfi IA (5′-GGCCATTACGGCC-3′) and Sfi IB (3′-GGCCGCCTCGGCC-5′) sites of the “prey” pPR3-C vector (Clontech). Series of combinations of bait and prey constructs were cotransformed into the yeast strain NMY51 (Clontech) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 LR cells) were individually re-amplified using the 5’ PCR Primer II A with CloneAmp HiFi PCR Premix (Clontech Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μl 5 U/μl Taq polymerase (Takara) and nuclease-free water to 30 μl ...
-
bioRxiv - Developmental Biology 2020Quote: ... and once in 5 ml NDiff227 (Takara Y40002). mESCs were then pelleted by centrifugation for 5’ at 1000rpm and resuspended in 500µl of NDiff227 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0), and 0.5 mM NADPH (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: 5 ml TALON metal affinity resin (TaKaRa Bio) was equilibrated with five column volumes of native lysis buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0). 500nM enzyme was added to start reaction ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were seeded in one well of a 6 well plate in supplemented DEF-CS (Takara). After a recovery period of 5 days ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Concentrated virus was plated on non-TC treated 6-well plates coated with retronectin (Takara T100B), and spun for 90 minutes at 1200xg ...
-
bioRxiv - Genetics 2021Quote: Adult ovary total RNA was used to amplify the 5’ and 3’ UTR of Pxmeiw68 and PxnanosP using the SMARTer RACE 5’/3’ Kit (Takara, Japan). 5’ and 3’ regulatory sequences were then cloned from 4th instar larval gDNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: First amplified with primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) using EmeraldAmp GT PCR Master Mix (TAKARA BIO) to minimize the amplification of non-bacterial taxa under the following cycling conditions ...
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Biochemistry 2024Quote: ... for A3>P: 5’-aaaacacugaaccug-3’ for A2>P: 5’-aaacacugaaccug-3’) were incubated with 10 U recombinant MazF (Takara Bio) in 20 mM Tris pH 8.0 ...
-
bioRxiv - Genetics 2024Quote: ... The 4–11 kb fragments of the DFR-B sequence were amplified by PCR using the primers DP-LF (5′-TTAACATGAGGGGATTGCATGTCACTTTCA-3′) and D3U-LR (5′-CATAAATCTGGTTCGAGTGGCAATCTAACT-3′) with Ex-Premier DNA Polymerase (TAKARA, Japan). The PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... The Y2H assays were performed in the Y2H Gold strain (PT4084-1, Takara 630489 ...
-
bioRxiv - Genetics 2021Quote: ... DsRed was detected by staining with rabbit anti-dsRed (Clontech 632496, 1:1000) followed by CyTM3-conjugated goat anti-rabbit (Jackson ImmunoResearch 111-165-144 ...
-
bioRxiv - Neuroscience 2021Quote: ... using anti-DsRed (1:500; RRID:AB_10013483; Living Colors DsRed polyclonal; Takara Bio USA). Tissues were rinsed ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-DsRed (1:500, RRID:AB_632496, Living Colors DsRed polyclonal; Takara Bio USA) and rat monoclonal anti-Troma1 (cytokeratin 8 ...
-
bioRxiv - Systems Biology 2021Quote: ... the inducible fluorescent protein was induced by adding 1 μg/ml doxycycline (Clontech) alone or together with 100 nM rapamycin (Harveybio ...
-
bioRxiv - Neuroscience 2021Quote: ... Stem101 (AB-101-U-050, 1:200 dilution; Takara Bio, Inc., Shiga, Japan), Stem121 (AB-121-U-050 ...
-
bioRxiv - Cell Biology 2021Quote: ... The human ezrin sequence was cloned into a pEGFP-N1 (Clontech; 6085-1). The human MISP and EGFP-MISP sequences were subcloned into modified pFastBac-6xHis-MBP plasmid LIC expression vector (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... was based on a pIRES2-EGFP vector (Clontech, Mountain View, CA; #6029-1). cDNA inserts from coding domain sequences (CDS ...
-
bioRxiv - Microbiology 2020Quote: ... Immunoblots were probed with mouse anti-GFP (1:10,000 JL-8, Clontech #632380) and rabbit anti-β-actin (1:10,000 Cell Signaling #4967 ...
-
bioRxiv - Neuroscience 2021Quote: ... hLAG3 expression was induced by 1 µg/ml of Doxycycline (DOX; Clontech #631311).
-
bioRxiv - Cancer Biology 2020Quote: ... Cellular proliferation was measured with a WST–1 cell proliferation assay system (Takara). WST–1 reagent was added to each well and incubated for 2 hours at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... AP-1-Luc or NF-IL6-Luc plasmid (Clontech, Pal Alto, CA, USA) using Lipofectamine 2000 for 24 h (Stratagene ...
-
bioRxiv - Plant Biology 2020Quote: ... Transferred proteins were first probed with anti-GFP (Takara Bio, 1:5,000 dilution) for 16 h ...
-
bioRxiv - Neuroscience 2020Quote: ... 1/3 (v/v) of LentiX™ Concentrator reagent (Clontech, Mountain View, USA) was added and incubated overnight (o/n) ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibody dilutions were used as follows: rabbit anti-DsRed 1:1000 (Takara), goat anti-ChAT 1:250 (Surmeli et al. ...
-
bioRxiv - Developmental Biology 2021Quote: Expression vectors for eGFP fusions were generated in eGFP N1 (Clontech, #6085-1) by subcloning of PCR fragments obtained using primers and template vectors shown in Supplemental Table S1 ...
-
bioRxiv - Cancer Biology 2021Quote: Tissues and cells were homogenized in 1 ml RNAisoTM Plus lysis buffer (TAKARA). Total RNA was extracted and 2 μg RNA was transcribed into cDNA with M-MLV reverse transcriptase (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Shield-1 ligand for stabilization of DD-tagged proteins was purchased from Takara Bio (Cat # 632189 ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was first treated by 1 Unit DNase I (RNase free, TaKaRa, China) at 37.0 °C for 20 min ...