Labshake search
Citations for Takara Bio :
851 - 900 of 1431 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2022Quote: ... 1 μg of RNA was used to prepare cDNA using the PrimeScript kit (Takara). cDNA equivalent to 100 ng of RNA was used for setting up the qPCR reaction using SYBR green master mix (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: Primary antibodies used in this study were rabbit anti-dsRed (Clontech, 632496, 1:200), mouse anti-GFAP (ZIRC ...
-
bioRxiv - Neuroscience 2023Quote: ... guinea pig polyclonal anti-RAX (1:200; M229 Takara Bio Europe Ab, Goteborg, Sweden); rabbit polyclonal anti-activated caspase 3 (AC3 ...
-
bioRxiv - Genomics 2023Quote: ... cells were co-transfected with 1 µg of pEGFP-N1 plasmid (Takara Bio USA). Where indicated ...
-
bioRxiv - Developmental Biology 2023Quote: ... The PCR amplified cDNA fragments were cloned into PEGF-N1 vector (Clontech,6085-1,) with XhoI/BamhI enzyme sites ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies used in this study include Rabbit-anti-DsRed (Clontech #632496, 1:1000), Goat anti-GFP (Sicgen ...
-
bioRxiv - Molecular Biology 2024Quote: ... The lysis buffer was prepared by mixing 1 µL RNase inhibitor (TaKaRa, Cat# 2313A) and 19 µL 10X lysis buffer (TaKaRa ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μg of RNA was reverse transcribed using PrimeScriptTM RT reagent Kit (Takara, #RR047A). Real-time quantitative PCR was performed using SYBR Green Mix (Abclonal ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... tissue was incubated overnight at room temperature in rabbit anti-DSred (Clontech; 1:2500) and mouse anti-TH (Immunostar ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 ml of 100 mM Isopropyl β-D-thioglactopyranoside (IPTG, Takara Bio Inc., Japan) was added to the culture medium ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then added to 1 mL of Talon cobalt resin (Takara 635652) and incubated with rotation for 1 hr at 4 C° ...
-
bioRxiv - Bioengineering 2024Quote: ... supernatants were harvested and mixed 1 to 3 with Lenti-X concentrator (Takara, 631232), cooled down to 4C for 30 minutes and spun down for 45 minutes at 4C.
-
bioRxiv - Biophysics 2024Quote: ... B0202S) with the presence of 1/250 volume of T4 ligase (Takara Bio, 2011A) at the concentration of 1.05-4.2 pg/µL at 37 °C for 20 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA was synthesized from 1 μg total RNA using a PrimeScript RT reagent kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA (1:10 diluted) was mixed with target-specific primers and SYBR Green Supermix (Takara). Data analysis was done using Viia7 sequence detection interface (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... beads were resuspended with 27 µl ddH2O and 1 µl 10× Ex-Taq buffer (TaKaRa). 1 µl proteinase K (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: The following antibodies were used for western blotting: mouse anti-GFP (1:5000; Clontech 632381), rabbit anti-Vinculin (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody used for western blotting (WB) was anti-GFP (Clontech #632592, dilution 1:1000). Secondary conjugated antibodies used for western blotting were Beta Actin HRP conjugated antibody (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were resuspended in 500uL FACS buffer with RNase inhibitor (Takara Bio 2313B, 1:500) and 0.5ul Propidium Iodide (ThermoFisher Scientific P3566 ...
-
bioRxiv - Neuroscience 2021Quote: ... Total RNA (1 µg) was reverse-transcribed with PrimerScript™ RT Master Mix (Takara, #RR047A) after DNase I treatment (Takara ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Neuroscience 2021Quote: ... The coding region of rGAT-1 was inserted into pEYFP-C1 (Clontech, Palo Alto, CA). QuikChange Site-directed Mutagenesis kit was utilized to introduce the GAT-1 variants into a wildtype GAT-1 plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... the annealed oligo duplex at a 1:3 mol ratio and ligation mix (Takara Bio) at 16 °C for 30 min ...
-
bioRxiv - Biophysics 2020Quote: ... and allowed to bind to cobalt resin (Talon, Clontech; 1 mL bed volume/L culture). The column was washed sequentially with cobalt wash buffer (CoWB ...
-
bioRxiv - Biophysics 2022Quote: HIV-1 Gag (75) was ligated into pEGFP-N1 (Clontech, Takara Bio, Mountain View, CA) to generate the HIV-1 Gag-EGFP vector ...
-
bioRxiv - Biophysics 2022Quote: HIV-1 Gag (75) was ligated into pEGFP-N1 (Clontech, Takara Bio, Mountain View, CA) to generate the HIV-1 Gag-EGFP vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the primers listed in Table 1 with the In-Fusion HD cloning system (Takara). To silence GSK3B expression ...
-
bioRxiv - Biochemistry 2020Quote: ... tricornutum genomic DNA using primers described in Table 1 (Supplemental Information) and Primestar polymerase (Takara) with primers LYS13-LYS16 ...
-
bioRxiv - Biochemistry 2020Quote: ... and the supernatant was mixed with 1 mL of TALON® metal affinity beads (Clontech) previously equilibrated with equilibration buffer (PBS pH 8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA (1 μg) was reverse transcribed by a reverse transcription kit (RR047A, Takara, China). Real-time quantitative PCR was performed on ABI 7500 system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Microbiology 2020Quote: The HSV-1 copy number was examined by qPCR using SYBR/ROX (RR82LR; Takara, Japan) on ABI qPCR machine (Lifetech ...
-
bioRxiv - Microbiology 2021Quote: ... protein expression was induced with 1 mM of isopropyl-β-D-thiogalactopyranoside (IPTG; Takara Bio) at the final concentration at 25°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Permeabilized cells were then mock treated or treated with 1 mg/ml RNase A (Takara) diluted in PBS for 20 minutes at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... rDA1m was immunostained using a rabbit anti-RFP antibody (1:1000, Takara, cat. number 632496) followed by a Cy3-conjugated donkey anti-rabbit secondary antibody (1:1000 ...
-
bioRxiv - Genomics 2020Quote: ... in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766, Clontech) to maximise the number of individual transformants (800,000 individual clones) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the final volume was increased to 1 mL using SOC medium (cat. no. ST0215, Takara) pre-warmed to 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 150 mM NaCl and 1 mM DTT]23 or CellAmp Processing Buffer (TaKaRa, Kusatsu, Japan) or Lysis Solution of SuperPrep (TOYOBO ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 μg was reverse-transcribed using PrimeScriptTM RT Reagent Kit (perfect Real Time) (Takara). RT-qPCR was performed with qPCRBIO SyGreen Mix LoRox polymerase (Cultek ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were treated with 200 ng ml−1 of Dox (#631311; TaKaRa, Kusatsu, Japan) for 24 h ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were pre-treated 1 hour prior to the assay with A/C Heterodimerizer (Takara) diluted at 1:200 in complete media concurrent with JF-Halo or -SNAP dye labeling ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by blocking solution containing primary antibodies against mCherry (mouse monoclonal 1:500, Takara Bio) and c-Fos (rabbit polyclonal 1:500 ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... 10 ng cDNA in a 25 μl reaction mixture containing 1 X ExTaq buffer (TaKaRa), 200 μM each of NTP and 800 nM of primers along with 0.625 units ExTaq HS (TaKaRa ...
-
bioRxiv - Plant Biology 2022Quote: ... was amplified using following primer pairs (AtEH1_1-527_GBD_F GCCATGGAGGCCGAATTCCCAATGGCGGGTCAGAATCCTAACATGG and AtEH1_1-527_GBD_R CTGCAGGTCGACGGATCCCCTTATGCAGAATATCCATT ACCTAGGTGATTAGC) and cloned into the pGBKT7 vector (Clontech). The cytoplasmic part of CLV1 (AA 671 to 980 ...
-
bioRxiv - Cancer Biology 2024Quote: 1 x 106 ACKP cells were transfected with 3 µg pE2F-TA-luc plasmid (Takara) and 0.3 µg renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Neuroscience 2024Quote: ... and resuspended in PBS with 0.3%BSA and 1% recombinant RNase inhibitor (RRI, Takara Bio). Next ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA libraries were then synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech; PT4097-1) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... the media was replaced and supplemented with 1 μg/mL aTc (Clontech catalog number 631310). After 24 h induction ...