Labshake search
Citations for Takara Bio :
801 - 850 of 4764 citations for QuantiChrom Indole Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... A Guide-it IVT RNA Clean-Up Kit (Takara Bio) was used to clean up the sgRNA solution ...
-
bioRxiv - Biophysics 2023Quote: ... were generated using In-Fusion HD Cloning kit (Clontech (TaKaRA)) following the supplier’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Transfection was done using the CalPhos mammalian transfection kit (Clontech). Alternatively ...
-
bioRxiv - Microbiology 2023Quote: ... using an In-Fusion HD Cloning Kit (TaKaRa, Cat# Z9633N). The plasmid was amplified using NEB 5-alpha F′ Iq Competent E ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan); PrimeScript RT-PCR Kit (Takara Bio ...
-
bioRxiv - Biophysics 2023Quote: ... were generated using In-Fusion HD Cloning kit (Clontech (TaKaRA)) following the supplier’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Virus titers were determined using AAVpro Titration Kit Ver2 (TaKaRa).
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA was extracted using a commercial kit (Takara, Japan) in line with the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted using the NucleoSpin RNA Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... cDNAs were synthesized using PrimeScript RT reagent Kit (Takara, Dalian) and then diluted and subjected to quantitative PCR using TransStart Green qPCR SuperMix (TransGen Biotch ...
-
bioRxiv - Genetics 2023Quote: ... cDNA was synthesized using the PrimeScript RT reagent kit (Takara) and used as templates for real-time PCR analysis using SYBR PreMix ExTaqII (Takara) ...
-
bioRxiv - Microbiology 2023Quote: ... using a DNA Ligation Kit (Mighty Mix, TaKaRa, Cat# 6023). The ligated constructs were then transformed in NEB 5-alpha F′ Iq Competent E ...
-
bioRxiv - Neuroscience 2023Quote: ... using SMARTer Ultra Low Input kit (634940, Takara Bio/Clontech). All samples were sequenced in parallel using Illumina NovaSeq 6000 flow cell and fastq files have been deposited on the Gene Expression Omnibus (GEO ...
-
bioRxiv - Neuroscience 2023Quote: ... using SMARTer Ultra Low Input kit (634940, Takara Bio/Clontech). All samples were sequenced in parallel using Illumina NovaSeq 6000 flow cell and fastq files have been deposited on the Gene Expression Omnibus (GEO ...
-
bioRxiv - Genetics 2023Quote: ... and Unique Dual Index Kit (U001-U024) (Takara Bio #634756) with some modifications ...
-
bioRxiv - Plant Biology 2023Quote: ... paired-ended libraries were constructed using SMART ChIPseq kit (TAKARA) and sequenced using HiseqX ...
-
bioRxiv - Plant Biology 2023Quote: ... and standard PCR was performed using ExTaq HS kit (TaKaRa). Control reactions were run using wild-type DNA as a template.
-
bioRxiv - Neuroscience 2023Quote: ... Infusion cloning (Takara-Bio In-Fusion HD cloning Kit; 639650) was used to clone in EF1-alpha promoter generating a pAAV.U6.shRLuc.EF1-α.ZsGreen.SV40 plasmid and express ZsGreen under EF1-α promoter (Table 2) ...
-
bioRxiv - Plant Biology 2024Quote: ... or the SMART-Seq mRNA LP Kit (Takara Bio USA) (for pre-parasitic J2 library generation) ...
-
bioRxiv - Microbiology 2023Quote: ... using an In-Fusion HD Cloning Kit (TaKaRa, Cat# Z9633N). Plasmids were amplified using NEB 5-alpha F′ Iq competent Escherichia coli (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNAs were prepared with SmarSeq Ultra Low input kit (Takara).
-
bioRxiv - Immunology 2023Quote: ... and spleen tissues using an RNAiso Plus kit (Takara Bio), and subsequently reverse transcribed into cDNAs ...
-
bioRxiv - Cell Biology 2023Quote: ... by PCR using a PrimeSTAR Mutagenesis Basal Kit (Takara, R046A) and the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... using the In-Fusion ® HD Cloning Kit (Z9648N; TaKaRa).
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was synthesized by SMART-Seq mRNA kit (Takara, 634772). Library DNAs were prepared according to the Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... SYBR RT-PCR Kit was purchased from Takara (Dalian, China). PHrodo-labelled E ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Biochemistry 2024Quote: ... and RNA extraction kit were bought from Takara (Dalian, China). Ultrapure water was employed throughout the work ...
-
bioRxiv - Bioengineering 2024Quote: ... AAV was purified with the AAVpro Purification Kit (Takara, 6666) according to manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2024Quote: ... using In-Fusion® HD Cloning Kit (Takara Bio, #639650). Subsequently ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared using SMART-Seq Stranded Kit (Takara Bio). The quality ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was prepared using PrimeScript cDNA Synthesis Kit (DSS Takara Bio India Pvt ...
-
bioRxiv - Developmental Biology 2024Quote: ... the SMART-seq v4 Ultra Low Input RNA kit (Takara) was used to prepare cDNAs starting from 1.5 µg of total RNA for each sample and sequencing libraries were prepared subsequently prepared using the Ovation Ultralow System V2 (NuGen) ...
-
bioRxiv - Cell Biology 2024Quote: ... and protein concentration was estimated by BCA Kit (Takara-#T9300A). For the assay ...
-
bioRxiv - Immunology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Physiology 2023Quote: ... The SMARTer Stranded RNA Pico Mammalian V2 kit (Takara Bio) was used to create Illumina sequencing libraries ...
-
bioRxiv - Genomics 2020Quote: ... 20 ng of sheared DNA was used for the library construction with ThruPLEX DNA Seq Kit and DNA HT Dual Index Kit (Takara Bio USA, Mountain View, CA). Plasma and tumor DNA libraries were sequenced using paired-end 50 bp reads generated on the NovaSeq 6000 Sequencing System (Illumina ...
-
bioRxiv - Genomics 2020Quote: The cfDNA library construction was performed with the SMARTer ThruPLEX Plasma-Seq Kit and DNA HT Dual Index Kit (Takara Bio USA, Mountain View, CA), as per manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... We prepared ligation-free ribosome profiling and total RNA-seq libraries from the clarified polysome lysates treated for 6 hours following the instructions provided with their respective kits (smarter-seq smRNA-seq kit, Takara-Clontech; NEBnext Ultra-Directional II) augmented with our previously-published ligation-free ribosome profiling protocol42 ...
-
bioRxiv - Biochemistry 2022Quote: ... Total RNA was isolated using RNAqueous isolation kit (Thermo-Fisher, Waltham MA) and mRNA reverse transcribed using PrimeScript RT Reagent Kit (Takara Bio USA, Mountain View CA). Quantitative PCR reactions were carried out using PowerUp SYBR-Green master mix using StepOne Real-Time PCR systems (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... samples were prepared for library prepraration using the SMARTer® Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian Kit for Sequencing (Takara Bio USA, Mountain View, CA). Total RNA was quantified and purity ratios determined for each sample using the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... Using the cDNA synthesis kit (TaKaRa: Moloney Murine Leukemia Virus Version), cDNA was synthesized from extracted RNA ...
-
bioRxiv - Biochemistry 2020Quote: ... Transfection was carried out with CalPhosTM Mammalian Transfection Kit (Takara Bio) at a ratio of pLL3.7:psPAX2:MD2G = 20:15:6 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was then prepared using the PrimeScript RT reagent kit (TaKaRa). QPCR reactions were performed according to the manufacturer’s instructions using SYBR® Premix Ex Taq kit (TaKaRa) ...
-
bioRxiv - Molecular Biology 2020Quote: ... total RNAs were extracted using the RNAplus Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... One-Step TB Green PrimeScript PLUS RT-PCR Kit (Takara Bio) was used under the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... with the high-fidelity One Step RT-PCR Kit (Takara Bio). PCR products were gel purified and cloned into the pCR4-TOPO vector using the Zero Blunt Topo Cloning Kit (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... The amplicons were purified by DNA Amplification Clean Up Kit (Clontech). Amplicons were pooled in equimolar ratios prior to library preparation ...
-
bioRxiv - Microbiology 2019Quote: ... the viral RNA was purified by NucleoSpin® RNA Kit (TAKARA). Recombinant INHis proteins (300 nM ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total RNA was extracted using NucleoSpin RNAII kit (Takara, Cat#740955.50). qRT-PCR was performed on 96-well optical reaction plates with one-step SYBR Green PCR master mix (Bio-Rad Laboratories ...