Labshake search
Citations for Takara Bio :
801 - 850 of 6565 citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification using proofreading DNA polymerases (Phusion HF, New England Biolab, Ipswich, MA) and In-Fusion HD Cloning Kit (Clontech, Mountain View, CA) or NEBuilder HiFi DNA Assembly Cloning Kits (New England Biolab) ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... for 15 min and then harvested for quantification of INF α mRNA using the One-step SYBR Prime script RT-PCR kit (TaKaRa, Dalian, China) according to the manufacturer’s protocol.Briefly the total RNA was isolated from TNF-α-treated with Trizol reagent (Takara Bio ...
-
bioRxiv - Genomics 2022Quote: ... Extracted RNA from each juvenile (as described in Methods S1) was converted to cDNA using PrimeScript RT-PCR Kit (Takara Bio, Shiga, Japan). The efficiency and specificity of the designed primers was tested through PCR using the GoTaq Green Master kit (Promega ...
-
bioRxiv - Microbiology 2023Quote: ... and real-time RT-PCR was performed by targeting the SARS-CoV-2 RdRp gene as follows: each 20 µl sample consisted of 12.5 µl One Step PrimeScript™ III RT-PCR Kit (Takara Bio, Shiga, Japan), 0.5 µM Sars-CoV-2 CRV forward primer (5’-TCACCTAATTTAGCATGGCCTCT-3’) ...
-
bioRxiv - Plant Biology 2023Quote: ... Each one or two PCR fragments were inserted into pMpGWB300 that was cleaved by HindIII and SalI using the In-Fusion Cloning kit (TaKaRa Bio, Kusatsu, Japan) to generate pMpGWB300:proMpRKD:MpRKD and pMpGWB300:proMpRKD:mMpRKD plasmids.
-
bioRxiv - Genomics 2024Quote: The Iso-Seq libraries were constructed from 1 µg of total RNA per sample and full-length cDNA were then generated using the SMARTer PCR cDNA synthesis kit (Takara Bio Inc, 639506). The libraries were sequenced on the Sequel Instrument v1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative real-time PCR was performed on a TP-850 Real-Time PCR Detection System (TAKARA Bio) using SYBR Green Premix ExTaq II ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was performed using the SYBR-Green PCR Master mix (SYBR® Premix Ex Taq™, Takara) and a CFX96 thermal cycler (BioRad) ...
-
bioRxiv - Immunology 2022Quote: ... and quantitative real-time PCR (q-PCR) was carried out using SYBR Premix Ex Taq (TaKaRa, Japan). Q-PCR was carried out in a Bio-Rad CFX96 system ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse PCRs were performed in two rounds using CloneAmp HiFi PCR premix (Clontech, Mountain View, CA, USA). The first round was performed adding the forward and reverse primers in two independent reactions and consisted of 3 cycles of 98 °C for 10 seconds ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1-st PCR (PCR 1) was performed using Titanium Taq DNA Polymerase (# 639209, Takara Bio, CA, USA). Separation of the PCR products from primers and gel purification was done by QIAquick PCR & Gel Cleanup Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed by SYBR Green PCR Master Mix (Takara). The primer sequences for qRT-PCR were listed in Table S15.
-
bioRxiv - Developmental Biology 2024Quote: ... 1 ul of the cDNA was used for PCR reaction using CloneAmp HiFi PCR Premix (Takara, 639298) with the following primers ...
-
Mice generated with induced pluripotent stem cells derived from mucosal-associated invariant T cellsbioRxiv - Immunology 2023Quote: ... and resultant RNAs (10 ng per sample) were subjected to cDNA library construction (SMARTer Mouse TCR a/b profiling kit, Takara Bio, Japan). The next generation sequencing was performed with MiSeq (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... RNA from 2 retinae of a mouse was extracted using the NucleoSpin® RNA kits (Takara Bio USA, Inc., San Jose, CA). RNA sample concentration and quality was determined with NanoDrop Oneᶜ Microvolume UV-Vis Spectrophotometers (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... and used to generate Illumina-ready heavy and light chain sequencing libraries using the SMARTer Mouse BCR IgG H/K/L Profiling Kit (Takara, Cat# 634422). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA prepared from adult mouse livers was reverse-transcribed using a PrimeScript II first-strand cDNA Synthesis Kit (Takara, Shiga, Japan) with a random hexamer primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-His6 (Clontech, 631212). Anti-Flag beads were purchased from SIGMA.
-
bioRxiv - Genetics 2019Quote: ... mouse Gla-Osteocalcin (MK127; Takara), mouse Osteopontin (MOST00 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mouse anti-mCherry (Clontech, 632543) 1:200 ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-GFP (Clontech, 632381), 1:10,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse-STEM101 (Takara Bio). Imaging was performed using Zeiss LSM880 or LSM900 confocal microscopes ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-mCherry (Clontech, 632543) at 1:450 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse fibroblast NIH-3T3 (Takara), human retinal pigment epithelial cells (hTERT-RPE1 or RPE1 ...
-
bioRxiv - Cell Biology 2024Quote: ... total mouse liver mRNA (Takara) was used.
-
bioRxiv - Cancer Biology 2019Quote: ... The PCR product was cloned into pcDNA6/luc/NP3 into a NotI-AgeI site using the Clontech In-Fusion kit (Clontech Laboratories, Mountain View, CA). To remove the two putative MIR211 sites ...
-
bioRxiv - Genomics 2019Quote: ... PCR products were collected by centrifugation at ~2250 xg for 20 min using the supplied SMARTer ICELL8 Collection Kit (Takara Bio USA, Cat.#640048).
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was normalized to 2ng in a total volume of 9μl and then transcribed to cDNA in a dedicated PCR clean workstation using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio, Mountain View, CA). Sequencing libraries were constructed from cDNA using the SMARTer ThruPLEX DNA-Seq kit (Takara Bio) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The corresponding full-length cDNA library was then generated using 1μg total RNA and the SMARTer PCR cDNA synthesis kit (Clontech, Takara Bio Inc., Shiga, Japan) following PacBio recommendations set out in the Iso-Seq method ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion and point mutation constructs were produced through inverse PCR using Takara In-Fusion HD cloning kit (#638920) (Takara Bio Inc., Kusatsu, Shiga, Japan). Primers used are listed in supplementary materials.
-
bioRxiv - Neuroscience 2020Quote: ... and a portion (1 ng) of the RNA were subjected to reverse transcription (RT) with a SMARTer™ PCR cDNA Synthesis Kit (Clontech, Mountain View, CA). Then ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cancer Biology 2022Quote: Human c-Jun sequence was amplificated using the cDNA of MCF7-BM02-1 and then transferred to pMXd3-PEF1-IRES-Puro vector using an In-Fusion Advantage PCR Cloning Kit (Clontech Laboratories Inc., CA, USA). The sequence encoding the transactivation domain of c-Jun in pMXs-Jun-IH was kindly provided by Dr ...
-
bioRxiv - Microbiology 2022Quote: RT-PCR was performed in a single closed tube using a one-step RT-PCR kit (One Step PrimeScript III RT-qPCR Mix, with UNG; Takara Bio Inc., Kusatsu, Japan) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR expression analysis was conducted on cDNA derived from immunoprecipitated RNA of OT:RiboTag mice following reverse (SMARTer® PCR cDNA synthesis kit; Takara Bio Inc., Shiga, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was performed on an ABI Prism 7500 Fast Real-Time PCR System using the SYBR Premix Ex Taq kit (Takara Bio Inc., Shiga, Japan) according to the instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR product was then cloned into pVV16-hsp60 between NdeI and HinDIII using In-Fusion® HD cloning kit (Takara Bio USA, Inc) and Stellar™ competent cells ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reactions at every examined depth were performed in triplicate (n=3) using Takara SpeedSTAR HS DNA polymerase kit (Takara Bio USA, Madison, WI) with the following modifications ...
-
bioRxiv - Immunology 2024Quote: ... reverse transcription and PCR steps were directly performed after sorting according to the SMART-Seq® v4 Ultra® Low Input RNA Kit protocol (Takara Bio, USA). Amplified complementary DNA were transferred to the Benaroya Research Institute (Seattle ...
-
bioRxiv - Biochemistry 2023Quote: ... The PCR fragments of spike protein DNA were cloned into linearized pMRNAXP vector using In-Fusion® HD Cloning Kit (Clontech® Laboratories, Inc.). The cloning mixtures were transformed to One Shot™ TOP10 Chemically Competent E ...
-
bioRxiv - Molecular Biology 2019Quote: ... and both long (NM_001300829) and short (NM_001280) isoforms of CIRBP were cloned by PCR (HiFi PCR premix, Clontech) from cDNA from Huh7 cells prepared with the Superscript III RT kit (Thermo Fisher ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant yeast strain was confirmed by PCR conducted with Matchmaker™ Insert Check PCR Mix (TAKARA, Japan). The full length of SlBES1.8 coding sequence was cloned into pGADT7 plasmid and subsequently transformed into the recombinant yeast strain ...
-
bioRxiv - Biochemistry 2020Quote: ... The quantification of gene transcripts was performed by quantitative PCR (Q-PCR) using SYBR Premix Ex Taq (TAKARA). All values were normalized to the level of β-actin mRNA ...
-
bioRxiv - Microbiology 2021Quote: ... and target genes were amplified by conventional PCR (50 µL reactions) with EmeraldAmp GT PCR Master Mix (Takara Bio ...
-
bioRxiv - Plant Biology 2020Quote: ... Partial genomic sequences of CpPT1 were PCR amplified in these preparations using SapphireAmp Fast PCR Master Mix (Takara) and the primer pair citron_Fw and citron_Rv (Supplementary Table 8) ...
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative RT-PCR was conducted on Bio-Rad CFX96 using the SYBR green PCR master mix (TaKaRa, Japan) with the primers listed in Appendix 1—key resources table ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with the PrimeSTAR Max DNA polymerase 2x hot-start PCR master mix (TaKaRa Bio, R045A). PCR products were purified using the AMPure XP PCR purification system (Beckman Coulter ...