Labshake search
Citations for Takara Bio :
801 - 850 of 1455 citations for 4 Chloro 2 iodothieno 2 3 b pyridine 5 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The non-solubilized fraction was separated by centrifugation at 47850 x g for 1 h at 4 °C and 4 mL of cobalt-charged TALON resin (Clontech, Takara) was added to the solubilized fraction for batch binding (3 h at 4 °C) ...
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μL of 5x PrimeScript buffer (Takara, USA), 1 μL RNAse OUT (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 4 U recombinant inhibitor (Cat. 2313B, TaKaRa) or SEQURNA thermostable RNase inhibitor (Cat ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ml of Lenti-X concentrator (Takara Bio) was added to 12 ml of cell supernatant and the mixture incubated at 4°C with gentle agitation for 18 hours ...
-
bioRxiv - Genomics 2022Quote: ... 3.5-4 million Lenti-X cells (Takara Bio) were seeded into 10 cm tissue culture dishes (Corning ...
-
bioRxiv - Bioengineering 2024Quote: ... and secretion signal 4 from pBIC4 (Takara, Japan) were incorporated upstream of the Lc and Hc genes ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Biochemistry 2023Quote: ... ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Microbiology 2021Quote: ... 5′-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... 5’ s-RACE cDNA was obtained from bulk-sorted B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Genetics 2021Quote: ... This plasmid was further used to generate backbone structure containing fust-1 promoter and mRFP, to which cDNAs of FUST-1 isoforms (isoform a, isoform b, and ΔN) were inserted by In-Fusion (Takara). The mRFP fused FUST-1 cDNA plasmids were used to generate cDNA only plasmids for splicing reporter rescue by removing the mRFP sequences using In-Fusion (Takara) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then further into the ClaI site of the avian replication-competent retrovirus vector RCASBP(B) (Li, Monckton, & Godbout, 2014) with the In-Fusion HD cloning kit (Clontech). The mutant construct that converts glutamine (Q ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-RACE cDNA was obtained from bulk-sorted B cells of each animal with SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The Ig PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... 10ng of RNA was used to prepare bulk TCR-seq libraries using the SMARTer Mouse TCR a/b Profiling Kit (Takara) according to instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... GA-MatryoshCaMP6s was amplified from pRSET B His-GA-MatryoshCaMP6s and subcloned into pDONR /Zeo via In-Fusion cloning (Takara Bio ...
-
bioRxiv - Immunology 2023Quote: ... A cDNA library for TCR was prepared from RNA using a SMARTer Mouse TCR a/b Profiling Kit (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using SMARTer Human TCR a/b Profiling Kit v2 (Takara Bio USA, San Jose, California, USA). Briefly ...
-
bioRxiv - Biophysics 2024Quote: ... for 35 min at 4°C and the supernatant was incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Purification Buffer and 10 column volumes of Purification Buffer with 10 mM imidazole before elution using Purification Buffer with 300 mM imidazole ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:4 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 2 and 10 column volumes of Membrane Buffer 2 with 20 mM imidazole before elution with Membrane Buffer 2 with 300 mM imidazole ...
-
bioRxiv - Microbiology 2024Quote: ... After co-cultivation, the organoids were collected and resuspended in 4% paraformaldehyde (PFA, Servicebio, China) at 4 [or RNAiso Plus (Takara, Japan) at −80□ for further analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... The non-solubilized fraction was separated by centrifugation at 47850 x g for 1 h at 4 °C and 4 mL of cobalt-charged TALON resin (Clontech, Takara) was added to the solubilized fraction for batch binding (3 h at 4 °C) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL dNTPs (25 mM; Takara Bio), 1 μL primers (10 pmol/μL each primer) ...
-
bioRxiv - Immunology 2022Quote: 5 × 106 GP2-293 packaging cells (Clontech) were plated in a 10 cm dish containing D10 medium (DMEM supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... 4µl 5× First-Strand buffer (Takara, #639538), and 1µl B-tag-sw oligo ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 5’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 × PrimeScript™ RT Master Mix (TAKARA) was used to synthesize cDNA ...
-
bioRxiv - Immunology 2024Quote: ... SMARTScribe reverse transcriptase (5 U/uL, Takara), Template-Switching Oligo (TSO ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNA sequences were amplified from 240μg of genomic DNA per sample with primers 5’AATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCG and 5’GTAATTCTTTAGTTTGTATGTCTGTTGCTAT TATG and ExTaq (Takara) polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... about ∼5 μg of bacmid were transfected using 5 μL of TransIT®-Insect transfection reagent (Takara Bio Inc.). 5 days after initial transfection ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 U and 8 U of MNase (TaKaRa 2910A) in MNase digestion buffer containing 20 mM Tris–HCl (pH 8.0) ...
-
bioRxiv - Genomics 2022Quote: ... 4 mL of lung tissue RNA (Takara Bio, 636524) at a final concentration of 500 pg per μl was used ...
-
bioRxiv - Immunology 2024Quote: ... and RNAse inhibitor (4 units) (Takara Bio, London, UK). After each plate was filled ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 ml TALON cobalt resin slurry (Takara Bio Inc.) was added (1 ml/tube ...
-
bioRxiv - Cancer Biology 2022Quote: ... After 48 hours supernatants were collected and employed to LAL-B cells in Retronectin (Takara Bionic Otsu, Shiga 520-2193, Japan) pre-coated no tissue culture 24-well plates (Falcon ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 grams or more of brain tissue was thawed on ice for 5 minutes with 5 ml of nuclei buffer (NB): 1% BSA containing 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... and NCIMB8826R using the pts1BCA_trunF (5’-TCGTCACCGAGTGTTCGTTT) and pts1BCA_trunR (5’-AGTTGCTGGCCACTGTTCAT) primers (Table S8) and ExTaq DNA polymerase (TaKaRa, Shiga, Japan). Thermal cycling conditions were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... dsDNAs were amplified by PCR using modified primers with 5’Bioton – 5 x phosphorothioate bonds (synthesized by eurofins) and PrimeSTAR Max (Takara).
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 LR cells) were individually re-amplified using the 5’ PCR Primer II A with CloneAmp HiFi PCR Premix (Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μl 5 U/μl Taq polymerase (Takara) and nuclease-free water to 30 μl ...
-
bioRxiv - Developmental Biology 2020Quote: ... and once in 5 ml NDiff227 (Takara Y40002). mESCs were then pelleted by centrifugation for 5’ at 1000rpm and resuspended in 500µl of NDiff227 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0), and 0.5 mM NADPH (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: 5 ml TALON metal affinity resin (TaKaRa Bio) was equilibrated with five column volumes of native lysis buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl 5× In-Fusion Enzyme Mix (Takara) were mixed in a total of 5 µl H2O ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0). 500nM enzyme was added to start reaction ...