Labshake search
Citations for Takara Bio :
751 - 800 of 992 citations for Siglec 2 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... Viral genome number was quantified by real-time PCR with AAVpro Titration Kit Ver.2 (Takara, 6233) according to manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2020Quote: ... SLD3 and ESA1 ORF were PCR-amplified with Taq polymerase (MightyAmp ver. 2, Takara Bio Co., Otsu, Japan) and cloned into the BamHI sites of the Y2H DB vector pST1667 and the Y2H AD vector pST548 (Tanaka ...
-
bioRxiv - Cell Biology 2020Quote: ... transformed with pGEX-4T-2-Bbs5-WT in the presence of 0.1 mM isopropyl-β-D-thiogalactopyranoside (Takara). The proteins were purified with the glutathione-Sepharose 4B protein chromatography purification kit (GE Healthcare) ...
-
bioRxiv - Genomics 2019Quote: ... Long range PCR was performed using Advantage 2 Polymerase following the manufacturer’s protocol (Clontech Laboratories, Mountatin View CA).
-
bioRxiv - Cancer Biology 2020Quote: Freshly harvested sorted LT-HSCs were starved in PBS for 2 hours and then fixed onto RetroNectin (Clontech)-coated slides ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Neuroscience 2020Quote: ... cell content was ejected onto 1.1 µl drop of lysis buffer (0.1% Triton X-100, 2 U/µl TaKaRa RNAse inhibitor ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 µg of total RNA was subsequently reverse transcribed to cDNA using PrimeScript RT Master Mix (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized using 2 μg RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Gene specific primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 μg of RNA was reverse transcribed in a 20 μL volume with RT PCR master mix (TaKaRa) as per the manual instruction ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed using gene-specific primers (Table 2) and TB Green Premix Ex Taq (Takara). Levels of gene expression were normalized to that of 16S rRNA and expression was assessed for each biofilm and each timepoint relative to its planktonic counterpart using the 2−ΔΔCt method (43).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Yeast 2-hybrid library screening was conducted using the Matchmaker Gold Yeast Two-Hybrid System (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Systems Biology 2019Quote: ... the samples were added to 2 μL of second-strand synthesis mix (2.5× NEB buffer 2 [New England Biolabs], 0.625 mM each dNTP Mixture [TaKaRa] ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
bioRxiv - Microbiology 2020Quote: ... The qPCR reaction system consisted of 12.5 μL of 2 × SYBR Premix Ex TaqTM II (Takara, Dalian, China), 0.5 μL of upstream and downstream primers (10 mM) ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...
-
bioRxiv - Genomics 2021Quote: ... Long range PCR was performed using Advantage 2 Polymerase following the manufacturer’s protocol (Clontech Laboratories, Mountain View CA).
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... The 2-μg RNA sample was reverse transcribed using the PrimeScript™ RT Master Mix (Takara, Shiga, Japan). Quantitative real-time PCR (qPCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was amplified by PCR in separate 25 μL reactions each containing 2 μL of cDNA for typically 7-9 cycles using 0.5 μL (2.5 u) LA Taq (Takara) with P5-3’ and miRCat-PCR-2 oligos (IDT ...
-
bioRxiv - Neuroscience 2023Quote: ... the cell body was immediately sucked into the glass electrode with negative pressure and expelled onto a 1.1 µl drop of the ice-cold lysis buffer (0.1% Triton X-100, 2 U/µl TaKaRa RNAse inhibitor ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Microbiology 2023Quote: HEp-2 cells were transduced with supernatants of Plat-GP cells cotransfected with pMDG60 and pRetroX-Tet3G (TaKaRa), selected with 4 mg/ml G418 (Wako) ...
-
bioRxiv - Microbiology 2023Quote: The pEGFP-C1 plasmids including AFF4 3’UTR sites “1-2-3” were generated using pEGFP-C1 (Clontech). The following complementary oligonucleotides were annealed in respective pairs as above (1.25 µM each in 75 mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... cultures were split into two 2-ml cultures of which one was supplemented with 250 nM rapalog (Clontech). Mislocalisation of the target protein was verified by live-cell microscopy.
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Genetics 2023Quote: ... electrophoresis was performed using 9 μL of the PCR products on a 2% agarose gel (Takara Bio, Japan) at 100 V ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus titer was quantified using the AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... and BFP/FAT-1/FAT-2 and T2A-NLS-mApple fragments were inserted with InFusion cloning (Takara Bio), as per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.3 μM gene-specific forward/reverse primers and 2 μL of diluted cDNA using a thermal cycler Dice (Takara). The reactions were carried out as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using 1–2 μL of the genomic DNA solution and Tks Gflex DNA polymerase (Takara Bio). The primers are listed in Table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.
-
bioRxiv - Microbiology 2021Quote: ... CPER mixtures contained 0.1 pmol of each DNA fragment and 2 µl of PrimeStar GXL DNA polymerase (Takara, Japan) in a total reaction volume of 50 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... The culture was split into two 2-mL cultures of which one was supplemented with 250 nM rapalog (Clontech). Parasite growth was determined via flow cytometry over five days as described above ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was clarified by centrifugation (292,055 g, 60 min, 4°C) and bound to 2 ml of TALON IMAC resin (Clontech) overnight with 10 rpm rotation in the presence of 20 mM imidazole and NaCl added up to 800 mM ...
-
bioRxiv - Microbiology 2022Quote: The recombinant pGBKT7-TaPHB-1 was transformed into Y2HGold yeast strain following the Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformants were screened on SD/-Trp agar plate ...
-
bioRxiv - Cell Biology 2022Quote: ... The yeast was transformed with the indicated plasmids using the Matchmaker™ Yeast Transformation System 2 (Clontech, Cat#: 630439). Two plasmids containing simian virus (SV ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2019Quote: ... Infected cells were cultured on Geltrex in NPC medium with 1 × RevitaCell supplement and 2 ug/ml Doxycycline (Clontech) to induce NGN2 gene expression ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated into the multiple cloning site 2 (MCS2) of the pTRE3G-BI vector (Clontech, Mountain View, CA, USA), resulting in the construct pTRE3G-BI/GPR83-LgBiT ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...