Labshake search
Citations for Takara Bio :
751 - 800 of 1258 citations for Mouse Anti Human Papilloma virus types 16 18 716 D1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... and anti-mCherry (632543, Clontech)) were diluted in blocking buffer and incubated with the membranes overnight at 4 °C ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-dsRed (Takara Bio) 1:500 or chicken anti-GFP (Abcam ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-dsRed rabbit polyclonal (Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit-anti-GFP (polyclonal, Takara) 1:5000 for denatured blots ...
-
bioRxiv - Plant Biology 2022Quote: ... or anti-mCherry (632543, Takara) antibodies at dilutions of 1:3000 and 1:2000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DsRed (Takara #632496), mouse anti-Actin (Sigma #A4700 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-DsRed (632496, Clontech). EdU+ cells were detected using the Click-iT EdU Imaging kit (Molecular Probes ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-DsRed (TaKaRa, 1:200), anti-F-actin (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-DsRed (TaKaRa, 1:10000), anti-actin (Abcam ...
-
bioRxiv - Neuroscience 2021Quote: ... mCherry (rabbit-anti-dsRed; Takara Bio ...
-
Mask, the Drosophila Ankyrin Repeat and KH domain-containing protein, regulates microtubule dynamicsbioRxiv - Neuroscience 2021Quote: ... rabbit anti-mCherry (632496, Clontech) at 1:1000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-DsRed (Takara, 632496), and mouse anti-Tnnt (ThermoFisher ...
-
bioRxiv - Biochemistry 2022Quote: ... or anti-GFP antibody (Clontech) for 1 hour at room temperature followed by a second incubation with HRP-conjugated secondary antibody (Santa Cruz Biotechnology) ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-RFP (Takara, 632543) primary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-DsRed (1:500, Clontech), anti-Synapsin I (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-dsRed (Takara Bio) 1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-dsRed (Clontech, 632496) at 1:300 ...
-
bioRxiv - Neuroscience 2023Quote: Rabbit anti-Dsred (Takara 632496)
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-DsRed (632496, Clontech), rabbit anti-Lcp1 (Jin et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-tdTomato (Takara, Cat.# 632496), anti-K14 (Biolegend ...
-
bioRxiv - Cell Biology 2024Quote: ... rabbit anti-Dsred (Takara, 632496), rabbit anti-VAChT (SYSY ...
-
bioRxiv - Developmental Biology 2020Quote: ... Northern blot analysis was performed on a membrane containing RNA from adult mouse tissues (Clontech). As probe ...
-
bioRxiv - Biochemistry 2022Quote: Mouse GTSF1 cDNA was synthesized at Twist Biosciences and cloned into pCold-GST (Takara Bio) bacterial expression vector by restriction cloning ...
-
bioRxiv - Microbiology 2022Quote: Total RNA from mouse corneas was extracted by the RNAiso plus reagent (TaKaRa, Dalian, China). RNA samples were reverse transcribed using HiScript III RT SuperMix (Vazyme ...
-
bioRxiv - Biochemistry 2022Quote: ... mouse DPPA3 cDNA was sub-cloned into a pGEX4T-3 plasmid using In-Fusion (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by blocking solution containing primary antibodies against mCherry (mouse monoclonal 1:500, Takara Bio) and c-Fos (rabbit polyclonal 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit primary anti-RFP (anti-DsRed Living Colors, 632496, Takara, Mountain View, CA, 1:1000) was followed with donkey anti-rabbit AF594 (715-586-152 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and TRIM27 cDNA was obtained in pENTR221 vectors from the UT Southwestern (UTSW) McDermott Center for Human Genetics and subcloned into pCMV-HA or pCMV-myc (Clontech, Mountain View, CA) between SalI and NotI restriction sites ...
-
bioRxiv - Systems Biology 2019Quote: ... PCR amplification allowed to obtain the coding sequence for human HSF1 that was cloned into peGFP N3 vector (Clontech Laboratories Mountain View, CA); the plasmid was then verified by sequencing (GATC Biotech ...
-
bioRxiv - Immunology 2022Quote: ... Viruses were packaged in human embryonic kidney (HEK) 293 cells and viral supernatants were processed using Retro-X concentrators (Takara Bio. USA Inc). Naïve CD8 T cells were purified by negative-selection and stimulated in vitro with plate-bound anti- CD3/CD28 ...
-
bioRxiv - Neuroscience 2021Quote: ... under control of the modified human GFAP promoter, GfaABC1D (Lee et al., 2008) using restriction cloning and In-Fusion HD assembly (Clontech, Takara Bio, USA). The following sequence elements were obtained from Addgene ...
-
bioRxiv - Biochemistry 2021Quote: A cDNA fragment encoding full-length human EGFR (UniProt accession no. P00533) was cloned into the pEGFP-N1 plasmid (Clontech, Mountain View, CA). To facilitate affinity purification ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Neuroscience 2022Quote: Human embryonic stem cell (hESC)-derived cerebral organoids (hCOs) were generated from a commercially available hESC stem cell line (Takara Bio, Osaka, Japan), using the STEMdiff cerebral organoid kit (STEMCELL Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1.25Lμg pVSV-G (second-generation lentivirus packaging system) into human embryonic kidney packaging cells GP2-293 (Clontech, Inc., Mountain View, CA, USA), using CalPhos™ Mammalian Transfection Kit (Clontech ...
-
bioRxiv - Cell Biology 2024Quote: ... A bicistronic construct expressing human EPAC1b with a C-terminal His10 tag and SUMO3(Q89K) was constructed using the pIRES2-EGFP vector (Clontech Catalog no. 632435). The EPAC1-His10-IRES-SUMO3(Q89K ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies: anti-GFP (chick 1:20) and anti-DsRed (rabbit, 1:50, Takara Bio#632496). Secondary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsred (1/1000; TaKaRa), mouse anti-acetylated Tubulin (1/500 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-DsRed (1:100, Clontech).
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:250; Clontech), mouse anti-ratCD2 (OX-34 ...
-
bioRxiv - Neuroscience 2019Quote: ... Rabbit anti-Dsred (1:250, Takara Bio ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:500; Clontech), mouse anti-rCD2 (OX-34 ...
-
bioRxiv - Neuroscience 2019Quote: ... rabbit anti-DsRed (1:1000, Clontech), mouse mAb anti-ChAT (1:100 ...
-
bioRxiv - Microbiology 2019Quote: ... Rabbit anti-GFP antibody (Clontech #632377) was used at 1:5,000 dilution ...