Labshake search
Citations for Takara Bio :
751 - 800 of 1332 citations for 6 NITRO 1 PHENYL 1H INDAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Total RNA (1 µg) was reverse-transcribed with PrimerScript™ RT Master Mix (Takara, #RR047A) after DNase I treatment (Takara ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Neuroscience 2021Quote: ... The coding region of rGAT-1 was inserted into pEYFP-C1 (Clontech, Palo Alto, CA). QuikChange Site-directed Mutagenesis kit was utilized to introduce the GAT-1 variants into a wildtype GAT-1 plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... the annealed oligo duplex at a 1:3 mol ratio and ligation mix (Takara Bio) at 16 °C for 30 min ...
-
bioRxiv - Biophysics 2020Quote: ... and allowed to bind to cobalt resin (Talon, Clontech; 1 mL bed volume/L culture). The column was washed sequentially with cobalt wash buffer (CoWB ...
-
bioRxiv - Biophysics 2022Quote: HIV-1 Gag (75) was ligated into pEGFP-N1 (Clontech, Takara Bio, Mountain View, CA) to generate the HIV-1 Gag-EGFP vector ...
-
bioRxiv - Biophysics 2022Quote: HIV-1 Gag (75) was ligated into pEGFP-N1 (Clontech, Takara Bio, Mountain View, CA) to generate the HIV-1 Gag-EGFP vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the primers listed in Table 1 with the In-Fusion HD cloning system (Takara). To silence GSK3B expression ...
-
bioRxiv - Biochemistry 2020Quote: ... tricornutum genomic DNA using primers described in Table 1 (Supplemental Information) and Primestar polymerase (Takara) with primers LYS13-LYS16 ...
-
bioRxiv - Biochemistry 2020Quote: ... and the supernatant was mixed with 1 mL of TALON® metal affinity beads (Clontech) previously equilibrated with equilibration buffer (PBS pH 8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA (1 μg) was reverse transcribed by a reverse transcription kit (RR047A, Takara, China). Real-time quantitative PCR was performed on ABI 7500 system (Applied Biosystems ...
-
bioRxiv - Genomics 2019Quote: ... 1 microgram of input RNA was used to generate cDNA (Clontech SMARTER cDNA synthesis kit), cDNA was size selected (3-6 kb ...
-
bioRxiv - Genomics 2019Quote: ... We mixed 2 µg of total RNA with 1 µl 10 mM dNTPs (Clontech #639125) and 1 µl of 50 µM SMART_dT18VN primer (for a complete list of primer sequences ...
-
bioRxiv - Molecular Biology 2020Quote: ... After incubation with horseradish peroxidase-conjugated secondary antibody (IgG detector, Takara Clontech, Cat# T7122A-1), the antigen was detected using chemiluminescence Western blotting detection reagents (Pierce ECL Western Blotting Substrate ...
-
bioRxiv - Microbiology 2020Quote: The HSV-1 copy number was examined by qPCR using SYBR/ROX (RR82LR; Takara, Japan) on ABI qPCR machine (Lifetech ...
-
bioRxiv - Microbiology 2021Quote: ... protein expression was induced with 1 mM of isopropyl-β-D-thiogalactopyranoside (IPTG; Takara Bio) at the final concentration at 25°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Permeabilized cells were then mock treated or treated with 1 mg/ml RNase A (Takara) diluted in PBS for 20 minutes at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... rDA1m was immunostained using a rabbit anti-RFP antibody (1:1000, Takara, cat. number 632496) followed by a Cy3-conjugated donkey anti-rabbit secondary antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2019Quote: ... cDNA was synthesized on 1 μg total RNA using the cDNA synthesis kit (TaKaRa, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766, Clontech) to maximise the number of individual transformants (800,000 individual clones) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the final volume was increased to 1 mL using SOC medium (cat. no. ST0215, Takara) pre-warmed to 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 150 mM NaCl and 1 mM DTT]23 or CellAmp Processing Buffer (TaKaRa, Kusatsu, Japan) or Lysis Solution of SuperPrep (TOYOBO ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 μg was reverse-transcribed using PrimeScriptTM RT Reagent Kit (perfect Real Time) (Takara). RT-qPCR was performed with qPCRBIO SyGreen Mix LoRox polymerase (Cultek ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSF-DUET-1-EIF6 construct was used to express eIF6 and the pTf16 (Takara Biosciences) construct was used to express the TF chaperone ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR products and pGEX6P-1 vector were digested with EcoRI (Takara Bio, Shiga, Japan) and NotI (Takara Bio ...
-
bioRxiv - Plant Biology 2022Quote: ... eGFP was immuno detected with anti-GFP antibody (1:4000 dilution) (JL-8, #632380, Takara) and anti- mouse-HRP (1:15000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... was amplified using following primer pairs (AtEH1_1-527_GBD_F GCCATGGAGGCCGAATTCCCAATGGCGGGTCAGAATCCTAACATGG and AtEH1_1-527_GBD_R CTGCAGGTCGACGGATCCCCTTATGCAGAATATCCATT ACCTAGGTGATTAGC) and cloned into the pGBKT7 vector (Clontech). The cytoplasmic part of CLV1 (AA 671 to 980 ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were treated with 200 ng ml−1 of Dox (#631311; TaKaRa, Kusatsu, Japan) for 24 h ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were pre-treated 1 hour prior to the assay with A/C Heterodimerizer (Takara) diluted at 1:200 in complete media concurrent with JF-Halo or -SNAP dye labeling ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by blocking solution containing primary antibodies against mCherry (mouse monoclonal 1:500, Takara Bio) and c-Fos (rabbit polyclonal 1:500 ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... 10 ng cDNA in a 25 μl reaction mixture containing 1 X ExTaq buffer (TaKaRa), 200 μM each of NTP and 800 nM of primers along with 0.625 units ExTaq HS (TaKaRa ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µg of total RNA was converted to cDNA using M-MLV reverse transcriptase (TAKARA) under standard conditions with oligo(dT ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were prepared from <=2.5ng input RNA using 1/4 volume SmartSeqv4 technology (Takara Bio) and sequenced on NextSeq High Output flow cells ...
-
bioRxiv - Microbiology 2023Quote: ... the media was replaced and supplemented with 1 μg/mL aTc (Clontech catalog number 631310). After 24 h induction ...
-
bioRxiv - Neuroscience 2023Quote: ... Rabbit primary anti-RFP (anti-DsRed Living Colors, 632496, Takara, Mountain View, CA, 1:1000) was followed with donkey anti-rabbit AF594 (715-586-152 ...
-
bioRxiv - Genetics 2023Quote: ... The detailed protocol was described in the manufacturer’s handbook (Yeast protocols handbook; PT3024-1; Clontech).
-
Exploratory mass cytometry analysis reveals immunophenotypes of cancer treatment-related pneumonitisbioRxiv - Immunology 2023Quote: ... The resultant cell pellets were then resuspended in Cellbanker 1 cryopreservation solution (Takara, catalog #210409). This suspension was aliquoted into cryovials and gradually frozen to –80°C and stored at –80°C until required for experimental analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... and resuspended in PBS with 0.3%BSA and 1% recombinant RNase inhibitor (RRI, Takara Bio). Next ...
-
bioRxiv - Cancer Biology 2024Quote: 1 x 106 ACKP cells were transfected with 3 µg pE2F-TA-luc plasmid (Takara) and 0.3 µg renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA libraries were then synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech; PT4097-1) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 mM MgCl2 and 2 μl of CIAP (Calf intestine AP, 30 U/μl: Takara#2250A). For the Endo H reactions ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 μg RNA was reverse transcribed using the PrimeScript RT reagent Kit with gDNA Eraser (Takara). The cDNA was then amplified for further analyses using deep sequencing on Illumina NextSeq platform ...
-
bioRxiv - Genetics 2021Quote: ... prepare non-tissue culture treated plates by adding RetroNectin (1 μg/μL; Takara Bio, Otsu, Japan) to enhance transduction efficiency ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Bioengineering 2021Quote: ... RNA (1 μg) was reverse transcribed using the Perfect real-time cDNA reverse transcription kit (TaKaRa). Quantitative PCR was performed with 1 μg of cDNA per sample per target gene using AceQ qPCR SYBR Green master mix (Vazyme ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of PB-Tet-On Advanced (containing PiggyBac Transposon sequences57 flanking rtTA-Advanced (Takara Bio) and puromycin selection cassette) ...
-
bioRxiv - Plant Biology 2021Quote: ... and the GFP fusion proteins were detected using the JL-8 (Clontech, 632380; 1:2500 dilution) as the primary antibody and an HRP-conjugated Affinipure Goat Anti-Mouse antibody (Proteintech ...
-
bioRxiv - Plant Biology 2021Quote: ... The gRNA - dCas9 complex was amplified (primers in Supplemental Table 1) and In-Fusion cloned (Clontech) into a SacI digested pMJS064 (described above ...