Labshake search
Citations for Takara Bio :
751 - 800 of 2390 citations for 6 Chloro 1 2 dihydro 3H indazol 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and the 3’ flanking region) and the linearized pHIS906 were fused using the In-Fusion enzyme (TAKARA, Shiga, Japan) to create the pHIS3-AWP1 plasmid ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... The plasmid for mCherry insertion was constructed with 1.5 kb long 5’ and 3’ arms amplified from the C57BL/6N genome using PrimeSTAR GXL DNA Polymerase (TaKaRa). The 5’ arm is the genomic sequence upstream of the stop codon of Rtl9 and the 3’ arm is downstream of the predictive Cas9 cut site ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription of mRNA was performed using 3-5 μg RNA with RNA to cDNA EcoDry Premix (Takara, #639549). For real-time PCR analysis ...
-
bioRxiv - Plant Biology 2023Quote: ... and SD4 (-Trp-Leu-His-Ade) media at 30℃ for 3–5 d according to the manufacturer’s manual (Clontech).
-
bioRxiv - Cell Biology 2024Quote: ... filtered through a 0.45 µm polyethersulfone filter and used directly or concentrated 3-fold with Lenti-X Concentrator (Clontech).
-
bioRxiv - Neuroscience 2024Quote: ... AAV was purified 3–5 days after transfection using AAVpro Purification Kit Midi or Maxi (Takara Bio, Shiga, Japan). The viral concentration was measured by qRT-PCR.
-
bioRxiv - Systems Biology 2021Quote: ... We prepared ligation-free ribosome profiling and total RNA-seq libraries from the clarified polysome lysates treated for 6 hours following the instructions provided with their respective kits (smarter-seq smRNA-seq kit, Takara-Clontech; NEBnext Ultra-Directional II) augmented with our previously-published ligation-free ribosome profiling protocol42 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Its male-specific exon was amplified using Advantage® 2 Polymerase Mix (TaKaRa), the gene-specific primer “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Genomics 2019Quote: ... Retroviruses were packed using the EcoPack 2-293 cells (Clontech, Mountain View, CA) and infections were performed as described12 ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA molecules were amplified using the Advantage 2 PCR kit (639206, Takara Bio) with initial denaturation at 95 °C for 1 min ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μL of 2× SYBR Premix Ex Taq II (TaKaRa, Beijing, China), 1 μL of cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and gene-specific primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized by adding 2 μl of PrimeScriptTM RT reagent kit (TaKaRa) to 500μg of RNA samples in 8 μl of distilled water (DW ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative real-time PCR was carried out using 2× TB-Green premix (TaKaRa) on a LightCycler-480®II (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and either 2 μg of the Tet-On-3G transactivator (pLVX Tet3G, Clontech) or 2 μg of the pLenti-CMVtight-Hygro-DEST plasmid with each cDNA of interest ...
-
bioRxiv - Biochemistry 2023Quote: ... the supernatant was incubated for 2 hr with TALON metal affinity resin (Takara) pre-equilibrated with 50 mM Tris-HCl [pH 7.6] ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lentiviral titers were measured using Lenti-X GoStix (PT5185-2; Clontech, Takara Bio) following instructions provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lentiviral titers were measured using Lenti-X GoStix (PT5185-2; Clontech, Takara Bio) following instructions provided by the manufacturer ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and primers specific for each gene ...
-
bioRxiv - Bioengineering 2020Quote: ... were mixed at a 1:1:1 ratio and bound to retronectin (Clontech)-coated plates according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... tubes with 1:1 FBS:PBS supplemented with recombinant RNase inhibitor (1:100, Takara). The live singlet gated CD3+ T cells were further gated as per the gating strategy shown in additional file 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′-GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... Specific forward and reverse primers (Suppl Table 3) were designed using the In-Fusion Cloning Primer Design Tool from TaKaRa (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting plasmids were co-transformed into Saccharomyces cerevisiae strain AH109 according to the protocols in the Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The yeast cells were cultured on SD/-Leu-Trp (-LW ...
-
bioRxiv - Molecular Biology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [18] (ii ...
-
bioRxiv - Genomics 2019Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′ -GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Pathology 2020Quote: ... The PCR assay was conducted as described previously9 and the complete genome termini was determined using the Takara SMARTer RACE 5’/3’ kit (TaKaRa) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... Primers P5 and P6 were annealed to create a dsDNA molecule encoding the sgRNA sequence with 5’ and 3’ extensions to enable InFusion Cloning (Clontech) into BtgZI-digested pL6 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5’ and 3’ RACE was carried out according to the manufacturer’s protocol of SMART RACE cDNA Amplification kit (Clontech, Takara, Japan). The sequences of primers for RACE are as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... interaction test and plasmid isolation were performed using the Yeast Protocols Handbook and Matchmaker GAL4TM Two-hybrid System 3 & Libraries User Manual (Clontech).
-
bioRxiv - Microbiology 2021Quote: ... CPER fragments containing WT or mutated or 3’UTRs were amplified from the plasmids using PrimeStar GXL polymerase (Takara, Japan) and gel-purified ...
-
bioRxiv - Plant Biology 2020Quote: ... The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196) and Atcox1-3’(+17..+38) using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4 minute-denaturation at 95°C ...
-
bioRxiv - Microbiology 2021Quote: Evaluation of protein interactions by the GAL4-based Y2H system was performed by following the manufacturer’s recommendations for the Matchmaker GAL4 Two-hybrid System 3 (Clontech, USA). Competent AH109 yeast cells (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [3] ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Biophysics 2020Quote: Target DNA containing the 5′-TTTA-3′ PAM was ordered from IDT and cloned into a pET28-MHL vector using the In-Fusion Cloning Kit (ClonTech). Plasmids were linearized before usage ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCRs (sqPCRs) were performed on 3 μl of cDNA template using Emerald Amp Max PCR Master Mix (Takara). The sequences of the primers used for PCR amplifications are included in Supplemental Table 4.
-
bioRxiv - Plant Biology 2022Quote: ... and pMKMM21 (3.5 kb upstream SYP12A:5’UTR:miniTurbo- Myc-SYP12A:3’UTR) were generated by in-fusion cloning (HD enzyme mix; Takara Bio). Gateway binary vectors pMKMM22 and pMKMM23 for the expression of miniTurbo-Myc- MpSYP13B and miniTurbo-Myc-MpSYP12A were generated by LR-recombination (LR clonase ...
-
bioRxiv - Neuroscience 2020Quote: ... cerevisiae strains used for yeast two-hybrid analysis were Y187 (MATα, ura3-52, his3-200, ade2-101, trp1-901, leu2-3, 112, gal4Δ, met–, gal80Δ, URA3::GAL1UAS-GAL1TATA-lacZ; Clontech) and Y2H Gold (MATa ...
-
bioRxiv - Molecular Biology 2020Quote: ... The sgRNA target locus on exon 3 or 5 was PCR amplified with Terra™ PCR Direct Polymerase Mix (Takara) for 35 cycles using primer sets mEX3F and mEX3R or mEX5F and mEX5R (Table 1) ...
-
bioRxiv - Genomics 2021Quote: ... These nanowells were selected for subsequent targeted deposition of 50□nl/nanowell RT-PCR reaction mix from the SMARTer ICELL8 3’ DE Reagent Kit (Takara) using the MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-GGC ATG GAC GAG CTG TAC AAG TCC AAT TTA CTG ACC GTA CAC-3’ and on pEGFP-C1 (Clontech) with primer ...
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Takara).
-
bioRxiv - Microbiology 2022Quote: ... A second construct for total gene deletion was generated by cloning the 5’ (843 bp) and 3’ (292 bp) homology regions amplified by PCR using a Taq DNA polymerase with proofreading activity (Takara) and primers P9 + P12 and P13 + P14 into the pL0001 vector (BEI Resources ...