Labshake search
Citations for Takara Bio :
701 - 707 of 707 citations for SARS CoV 2 Spike Glycoprotein S2 Sheep Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... at a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding the PX domain from the Qc SNARE Vam7 (Amino acyl residues 2-123) was amplified by PCR with CloneAMP HiFi PCR premix (Takara Bio USA, Mountain View, CA, USA). The amplified DNA fragment was cloned into BamHI and SalI digested pGST parallel1 vector (Sheffield et al.,1999 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...