Labshake search
Citations for Takara Bio :
701 - 750 of 6421 citations for Rat Epithelial membrane protein 1 EPN3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... using the In-Fusion kit (Takara, 638911). The ligated product was transformed into Stellar competent cells accompanying the In-Fusion kit ...
-
bioRxiv - Neuroscience 2023Quote: ... and In-Fusion HD Cloning Kit (Takara) following the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2023Quote: ... vector using In- Fusion cloning kit (Takara). MAP2C 1SP was created by removing “S/P region” (P134-P251 in the numbering of 471 amino acids isoform ...
-
bioRxiv - Cell Biology 2023Quote: ... PrimeScript™ RT reagent kit (TaKaRa, RR036A) is used to generate cDNA from RNA extracted ...
-
bioRxiv - Immunology 2023Quote: ... or PrimeScript RT reagent Kit (Takara, RR037A) and TB Green Premix Ex Taq (Tli RNaseH Plus ...
-
bioRxiv - Biophysics 2023Quote: ... or the InFusion cloning kit (Takara Bio) and the corresponding primer sets (Table S1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and fluorescence quantitative kit (Takara Bio, Japan). The primer sequence is the same as Table 1 mentioned in 2.7
-
bioRxiv - Synthetic Biology 2023Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Cancer Biology 2023Quote: ... using In-Fusion HD kit (Takara Bio) following the manufacturer’s manual ...
-
bioRxiv - Cancer Biology 2023Quote: ... A reverse transcription kit (Takara, Tokyo, Japan) was used as per the kit’s instructions to perform reverse transcription ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... a reverse transcription kit (TaKaRa, Shiga, Japan) was applied to reverse transcribe 1000ng total RNA into cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... The In-Fusion HD cloning kit (Clontech) was used for cloning according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... an EpiTaq hot start kit (TaKaRa Bio), a CloneJET PCR cloning kit (Thermo Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... The Capturem EV isolation mini kit (Takara) was used following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... using an In-Fusion cloning kit (Takara).
-
bioRxiv - Cell Biology 2024Quote: The In-Fusion cloning kit (Takara Bio) was used according to manufacturer’s guideline to clone cDNAs into pUASTattB (kindly provided by K ...
-
bioRxiv - Neuroscience 2024Quote: ... and In-Fusion HD Cloning kit (Clontech), respectively ...
-
bioRxiv - Immunology 2024Quote: ... The SMART-Seq Stranded kit (Takara #634444) was used for cDNA synthesis and amplification ...
-
bioRxiv - Genomics 2024Quote: ... using random primer DNA labeling kit (Takara). A total of 100 ng FISH probes were suspended with hybridization buffer (50% formamide ...
-
bioRxiv - Cell Biology 2024Quote: ... by using In-Fusion cloning kit (TaKaRa). For pAAVS1-Nst-MCS (Addgene #80487) ...
-
bioRxiv - Cell Biology 2024Quote: ... The PrimeScript RT Master Mix Kit (TaKaRa) was used to generate cDNA from the extracted RNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... using an In-Fusion cloning kit (Takara).
-
bioRxiv - Neuroscience 2024Quote: ... or In-Fusion HD Cloning Kit (TaKaRa). The GFP-fused full-length NCAN-expressing plasmid was constructed by inserting the fragment encoding GFP amplified from the pCAG-GFP vector into the central region of NCAN (corresponding to Val641 to Leu644) ...
-
bioRxiv - Bioengineering 2022Quote: HEK293T cells were harvested for RNA extraction using RNeasy Plus Mini Kit (Qiagene) or NucleoSpin RNA Plus Kit (Takara). RNA concentration was measured by nanodrop and 500ng to 1000ng total RNAs were used for reverse transcription in 10 ul reaction volume by High-Capacity RNA-to-cDNA kit (ThermoFisher) ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription (RT) was then initiated with the cDNA synthesis kit (PrimeScript™ 1st strand cDNA Synthesis Kit; Takara) using the random hexamers option ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was converted to cDNA with the PrimeScript™ RT reagent Kit Prime Script TMRT reagent Kit (Takara, Japan), and the cDNA was analyzed by qRT-PCR using TB Green® Premix Ex TaqTM II (Takara ...
-
bioRxiv - Microbiology 2020Quote: 5’-RACE analysis was performed using SMARTer RACE 5’/3’ kit and In-Fusion HD Cloning kit according to the manufacturer’s instructions with slight modifications (Clontech). 5’-RACE ready cDNA was synthesized from purified mRNA (TG ...
-
bioRxiv - Immunology 2021Quote: ... Cells were harvested after 3 d and AAV6 was purified with a filtration-based kit (Takara AAVpro Purification Kit) per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... The extracted probes were radioactively labeled with 2.5 μl [alpha-32P] dCTP (Amersham) according to the instructions of the kit (LaddermanTM Labeling Kit, Takara). The probe was mixed with 100 μl TE buffer (10mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... library preparation was performed using the SMARTER Stranded Total RNA Seq kit v2-Pico Input Mammalian kit (Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... chimeric fluorescence detection kit and TB Green Premix Ex Taq™ (Tli RNaseH Plus) kit were obtained from Takara Biomedical Technology (Beijng ...
-
bioRxiv - Zoology 2024Quote: ... and reverse transcribed using the PrimeScriptTM RT reagent Kit with gDNA Eraser (Perfect Real Time) kit (Takara, Dalian, China). The RT-qPCR reactions were carried out on the PikoReal 96 Real-Time PCR System (Thermo ...
-
bioRxiv - Microbiology 2022Quote: ... 1% PS and doxycycline (1 μg/ml; Takara, Cat# 1311N). At 7 days posttransfection ...
-
bioRxiv - Microbiology 2022Quote: ... 1% PS and doxycycline (1 μg/ml; Takara, Cat# 1311N). At six days posttransfection ...
-
bioRxiv - Microbiology 2021Quote: ... 1% PS and doxycycline (1 μg/ml; Takara, cat# 1311N). At six days posttransfection ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Plant Biology 2021Quote: ... All Rec and Rad proteins were translationally fused with the Activation Domain (AD) of pGADT7 AD (Takara Bio). βC1 was fused with Binding Domain (BD ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP-TSN-interacting proteins and native TSN were detected by mouse α -GFP (monoclonal antibody JL-8; Clontech) and rabbit α-TSN antibodies at final dilutions of 1:1,000 and 1:5,000 ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA isolation and reverse transcription were performed as described in the STAR METHODS section “Ddi2 expression analysis in mouse embryos using qRT-PCR.” Constructs encoding the DDI2WT and DDI2PD proteins were cloned into p905 (gift from Pavlína Řezáčová, IOCB CAS, Prague) and pTreTight (Clontech) expression vectors.
-
bioRxiv - Developmental Biology 2022Quote: ... The expression of Dunk protein was confirmed by Western blot using c-Myc Monoclonal Antibody (Takara, Cat# 631206). Then ...
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).