Labshake search
Citations for Takara Bio :
701 - 750 of 1297 citations for Mouse Anti Canine Parvovirus 2 Antibody 5G7 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Plant Biology 2022Quote: ... bHLH39-1 and bHLH39-2 fused to the BD were co-transformed into yeast Y2HGold (Clontech). Transformants were grown on SD-Leu-Trp plates ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Plant Biology 2023Quote: ... and gametandiopore of one-month-old Tak-1 and Tak-2 by NucleoSpin RNA Plant (Takara) or Monarch Total RNA Miniprep Kit (New England BioLabs ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Biophysics 2021Quote: ... and anti-mCherry (#Z2496N, TaKaRa, Shiga, Japan).
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti- dsRed (1:500; Takara Bio), guinea pig anti-Loaf (1:400 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-DsRed 1:1000 (Clontech, #632496), mouse anti-Arm 1:3 (Hybridoma Bank ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-DsRed (Clontech, 632496, 1:200), mouse anti-Tubulin (Sigma T5168 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (1:500, Clontech #632496), goat anti-rat 647 (1:400 ...
-
bioRxiv - Physiology 2019Quote: ... Guinea pig anti-glucagon (Takara, 1:2000), Rabbit anti-MafB (Bethyl ...
-
bioRxiv - Neuroscience 2019Quote: ... Rabbit anti-DsRed (Clontech, Mountain View, CA) and chicken anti-GFP (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... 1:400 rabbit anti-DsRed (632496, Clontech), 1:800 mouse anti-mGluR1a (556389 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-GFP clone JL-8 (Takara 632381) 0.5 µg/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-DsRed (1:1000, 632496, Clontech); rabbit anti-HA (1:300 ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-GFP (Clontech 632381 1:2000). Membrane was then washed three times in 1x TBST and incubated with goat-anti-rabbit (Jackson ImmunoResearch 111-035-046 1:5000 ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-GFP (Clontech 632381 1:2000). The membrane was then washed three times in TBST and incubated with goat-anti-rabbit (Jackson ImmunoResearch 111-035-046 1:5000 ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (1/500, Clontech, 632496). Sections were then incubated for 2 h at room temperature with appropriate fluorescent secondary antibodies diluted in PBS – 1% normal serum ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (1:1000) (632496, Clontech), goat anti-CGRP (1:500 ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-GFP 1:1000 (Clontech, 632380), anti-α-syn 1:1000 (C-20 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-dsRed (632496, Clontech; 1:300).
-
bioRxiv - Cell Biology 2020Quote: ... anti dsRed at 1:500 (Takara #632496), anti Polyubiquitin (“PolyUb” ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal anti-DsRed (1:500; ClonTech). The secondary antibodies Cy3 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (1:500, Clontech #632496), goat anti-mCherry (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-DsRed (1:500, Clontech). Secondary antibodies used were Alexa Fluor 633 goat anti-mouse ...
-
bioRxiv - Molecular Biology 2022Quote: ... Anti-6xHis (631212, 1:10,000) from Clontech. Anti-Ubiquitin (646302 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-H3K27me1 (1:1000, Takara, #MABI0321-100I), anti-H3K27ac (1:4000 ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-dsRED 1:1000 (Clontech, Cat.no. 632496), anti-Tbr1 1:1000 (Abcam ...
-
bioRxiv - Developmental Biology 2019Quote: ... Rabbit anti-Dsred (1:100; Takara, 632496), Mouse anti-Trio (1:100 ...
-
bioRxiv - Physiology 2019Quote: ... rabbit anti-DsRed (1:500, #632496 Clontech), mouse anti-Neurofilament-M (1:50 ...
-
bioRxiv - Biochemistry 2019Quote: ... anti-GFP-tag (Living Colors 632592; Clontech), anti-Strep-tag (34850 ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-dsRed (1:200, Takara, #632496), Alexa488 goat anti-mouse (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... Rabbit anti-dsRed (1:100, Clontech, 632496), Rabbit anti-Neuroglian (1:50 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and blotted with anti-GFP/YFP (Clontech). After HRP-conjugated secondary antibody incubation ...
-
bioRxiv - Genetics 2020Quote: ... including rabbit anti-RFP (Clontech, 1:1000), mouse anti-V5 (MCA1360GA ...
-
β-importins Tnpo-SR and Cadmus and the small GTPase Ran promote ovarian cyst formation in DrosophilabioRxiv - Developmental Biology 2021Quote: ... rabbit anti-dsRed (#632496, Clontech; 1:500), rabbit anti-phosphoHistone H3 (pHH3 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (1:400, Clontech 632496), chicken anti-GFP (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-DsRed (1:500, rabbit, Takara Bio ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-dsRed (1:200, Takara, #632496), Alexa488 goat anti-mouse (1:500 ...