Labshake search
Citations for Takara Bio :
701 - 750 of 2147 citations for Indeno 1 2 3 Cd Pyrene D12 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Primers were designed using the Takara Bio Perfect Real Time Support System (Takara Bio, Table 2). Primers were diluted to 50 µM in ddH20 and stored at -20°C ...
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Amplified cDNA from the ICELL8® 3’ DE Chip individual cells was collected and pooled using the ICELL8® Collection Kit (Takara Bio) by centrifugation at 3,200 x g ...
-
bioRxiv - Microbiology 2021Quote: 5’-RACE PCR was performed on total RNA from VSVg-NL43 infected CD4+ T cells and MDMs following the manufacturer’s protocol for SMARTer® RACE 5’/3’ Kit (Takara Bio, Cat: 634858). Random primers were annealed to template RNA using 10X Random Primer Mix ...
-
bioRxiv - Microbiology 2020Quote: pEX18Tc-hpdA was constructed for gene knockout by fusing the erythromycin resistance gene and two upstream and downstream fragments of the target gene amplified with the primers shown in Table 3 to Sac I/Hind III-digested pEX18Tc with the In-Fusion® HD Cloning Kit (TaKaRa, Dalian, China). The resulting plasmid pEX18Tc-hpdA was transformed into E ...
-
bioRxiv - Plant Biology 2021Quote: Transcription start sites were characterised by cloning and sequencing 5’ RACE products using the SMARTer RACE 5’/3’ kit (Takara Bio USA, Inc). In summary ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from a pooled female pupal RNA sample and also from a pooled adult female ovary sample (RNA extracted using RNeasy MinElute kit, RACE conducted using SMARTer 5⍰/3⍰ RACE kit - Takara Bio, Kyoto, Japan). Visible bands were cloned using the NEB PCR cloning kit (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech, Mountain View, C.A.) as described (44) ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 were determined by DNA gel extraction and sequencing after rapid amplification of cDNA ends (RACE) using the SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and internal primers designed from P ...
-
bioRxiv - Microbiology 2023Quote: ... or the BamHI/MluI site of pWPI-ACE2-zeo (for ACE2 expression plasmids)43 with 3×FLAG-tag at the C-terminus using In-Fusion® HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Biochemistry 2023Quote: ... The endogenous pfrkip locus was targeted by cloning 20 nucleotide guide region (5’-ATAATTGGTGCCAAATTGAA-3’) with primer pair GRKIPV5F/ GRKIPV5R using In-Fusion (Clontech, Mountain View, CA) in pL6eGFP plasmid [53] generating pL6eGFPgV5 plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... Correct disruption and integration were confirmed by genomic PCR at the 5′ and 3′ ends using KOD FX Neo (TaKaRa Bio Inc., Japan). We confirmed that N-terminally GFP-tagged Bqt4 is functional ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transfected cells were cultured for over 3 weeks in complete RPMI-1640 medium containing G418 (600 μg/ml; Clontech, Palo Alto, CA, USA) to select resistant clones.
-
bioRxiv - Plant Biology 2023Quote: The 5’ and 3’ experiments were conducted with the use of SMARTer® RACE cDNA Amplification Kit (Takara Bio, United States, Cat# 634860) and Advantage Polymerase as described by Kruszka et al ...
-
bioRxiv - Neuroscience 2023Quote: ... Media containing lentiviral particles was collected 72 hours post-transfection and the lentiviral particles were precipitated with 3 volumes of Lenti-X Concentrator (Takara, cat. no. 631232) at 4°C overnight ...
-
bioRxiv - Plant Biology 2023Quote: ... the genomic sequence from the MpRKD promoter region (3827 bp upstream from start codon) to the 3’UTR was amplified by PCR with PrimeSTAR HS DNA polymerase (TaKaRa Bio, Kusatsu, Japan) and the primers IF-Hind-pRKD-F and IF-Sal-gRKD-R ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 µM of Shield-1 peptide (Clontech, Mountain View CA) for 4-6 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μM of Shield-1 peptide (Clontech, Mountain View CA) for 4 h ...
-
bioRxiv - Molecular Biology 2024Quote: - IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Molecular Biology 2024Quote: IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Cancer Biology 2019Quote: ... 3 μg of total RNA was reverse transcribed to cDNA with Oligo(dT)15 primers using PrimeScript™ Reverse Transcriptase (Takara Bio, Shiga, Japan). The resultant cDNA was subjected to real-time PCR by using SYBR® Premix Ex Taq™ II (Takara Bio ...
-
bioRxiv - Biochemistry 2021Quote: ... (ii) addition of a second adapter on the 3’ end of the cDNA during reverse transcription using SmartScribe RT (Clontech Biotechnologies, Mountain View, CA) as previously described (63) ...
-
bioRxiv - Biochemistry 2022Quote: ... 53) and Hif1β shRNA (target sequence: 5’-GGACAGAGATCCAAGGTTT-3’) were cloned into the pSIREN-RetroQ expression vector (631526; Clontech Laboratories Inc., Mountain View, CA). The FLAG-tagged mouse Pdx1 coding sequence was amplified by PCR and subcloned into a pMXs-Neo Retroviral vector (RTV-011 ...
-
bioRxiv - Biochemistry 2019Quote: ... RACE-PCR was conducted with combination of fat body 3’RACE ready cDNA and RACE primers (Table S3) according to the manufacturer’s protocol (Takara Bio, Mountain View, CA, USA). The ORF was obtained by assembling the RACE fragment and the corresponding fragment obtained from the transcriptome ...
-
bioRxiv - Immunology 2020Quote: ... Virus concentration was estimated by p24 titration using the FLAQ assay76 (HIVGKO and VLPs) or the Lenti-X™ p24 Rapid Titer Kit (Clontech; HIVNL4-3/Luciferase).
-
bioRxiv - Developmental Biology 2020Quote: ... Lentiviral supernatant titers were determined by Lenti-X p24 Rapid Titer Kit (supplemental Table 3) according to manufacturer’s protocol (Takara Bio USA, Inc. California, U.S.A).
-
bioRxiv - Developmental Biology 2021Quote: PCR products were subcloned in frame with GFP sequence in 3′ into pCS2+-GFP vector using In-Fusion® HD Cloning Kit (Takara Bio USA, Inc.). For rescue experiments ...
-
bioRxiv - Neuroscience 2022Quote: Jacob-LMO4 interaction was reconfirmed using fusion vectors (bait vector pGBKT7, prey vector pGADT7) using MATCHMAKER Two-Hybrid System 3 (Takara Bio Europe/Clontech, France). Co-transformed yeasts were assayed for growth on quadruple drop-out medium (SD/–Ade/–His/–Leu/–Trp ...
-
bioRxiv - Cell Biology 2024Quote: ... Ten nanograms of RNA were used for preparing indexed libraries using SMARTer Stranded Total RNA-Seq Pico-Input Mammalian kit v.3 (Takara Bio. Cat# SKU: 634487) as per manufacturer’s instructions (except that fragmentation was performed for 3 minutes of fragmentation at 94 °C and 13 cycles was used for PCR2) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reactions at every examined depth were performed in triplicate (n=3) using Takara SpeedSTAR HS DNA polymerase kit (Takara Bio USA, Madison, WI) with the following modifications ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was amplified from WT genomic DNA by PCR using Advantage 2 Polymerase (#639202, Takara Bio, USA). Plasmid backbones were double-digested with the necessary restriction enzymes and purified using the Qiagen DNA purification kit (#28704X4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 50% fresh RPMI medium supplemented with 20 U/ml IL-2 and spin-fected on RetroNectin (Takara)-coated plates at 3000 g at 32°C for 2 h ...
-
bioRxiv - Physiology 2021Quote: ... 2 µL of the synthesized cDNA was mixed with SYBR Premix Ex Taq II (Takara Bio Inc.) and 0.4 µM primers (same as above ...
-
bioRxiv - Molecular Biology 2022Quote: ... the JAK3 open reading frame was amplified by PCR using the Advantage 2 polymerase mix (Takara Bio) with JAK3-ORF primers (Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... Make Your Own “Mate & Plate™” Library System and Yeast Transformation System 2 were purchased from TaKaRa. Synthetic-defined (SD ...
-
bioRxiv - Immunology 2021Quote: ... Synthesis of cDNA was performed by using 2 μg of total RNA with PrimeScriptTM Reverse Transcriptase (Takara) according to the manufacturer’s instructions ...