Labshake search
Citations for Takara Bio :
701 - 750 of 1054 citations for Dengue Virus Serotype 2 Envelope Protein HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Plant Biology 2019Quote: ... proteins were transferred to PVDF membrane and blotted proteins were incubated in a 1:10,000 dilution of mouse monoclonal anti-GFP antibody (Living Colors JL-8, Clontech) followed by 1:5000 horseradish peroxidase conjugated sheep anti-mouse IgG antibody (Amersham ...
-
A GID E3 ligase assembly ubiquitinates an Rsp5 E3 adaptor and regulates plasma membrane transportersbioRxiv - Cell Biology 2021Quote: ... pGADCg- and pGBKCg-based plasmids containing the indicated protein fusions were transformed into the yeast strain Y2HGOLD (Takara Bio), and double transformants were selected by growth on SD media lacking leucine and tryptophan ...
-
bioRxiv - Microbiology 2020Quote: ... lysed by sonication and the recombinant His-tagged protein purified from cell-free extracts using IMAC (Talon resin, Clontech) as previously described19.
-
bioRxiv - Microbiology 2019Quote: ... The Pfc43opt recombinant protein was soluble and purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...
-
bioRxiv - Cell Biology 2021Quote: ... red fluorescent protein fused with the mitochondrial targeting sequence from cytochrome c oxidase subunit VIII (Clontech, Mountain View, CA) using Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... NPR1-GFP proteins were detected by reacting the blots with the mouse monoclonal anti-GFP monoclonal antibody (Clontech, USA) and horseradish peroxidase-conjugated secondary antibody (Santa Cruz ...
-
bioRxiv - Cell Biology 2020Quote: ... Purification of 6X-Histidine tagged cavin proteins was done using TALON metal affinity resin (ClonTech, Scientifix Cat No. 635503). Talon resin was thoroughly washed with 500GF buffer containing 5 mM imidazole to remove detergent and non-specifically bound proteins ...
-
bioRxiv - Biochemistry 2022Quote: The recombinant protein in the soluble fraction was then purified using TALON Metal Affinity Resin (Clontech Laboratories, CA, USA) per manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: Y2H protein interaction assays were performed according to the manufacturer’s instructions as described in the Yeast Protocols Handbook (Clontech; TaKaRa Bio USA ...
-
bioRxiv - Molecular Biology 2022Quote: ... red fluorescence protein (DsRed) and NK-NT or NKN1 fragments were cloned into pET6xHN-N Vector (Takara, CA, USA). HEK293T cells were cultured in FP medium (DMEM containing 10% FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equal loading of the GFP tagged E2F1 proteins was determined by the GFP antibody (Clontech, lot. 1404005; 1:2000) the secondary antibody anti-rabbit HRP (Na934v ...
-
bioRxiv - Biochemistry 2024Quote: ... The other 2A proteins were separated from the lysate using immobilized metal affinity chromatography with either TALON beads (Clontech) or chelating Sepharose beads charged with NiCl2 (Cytiva) ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was amplified from WT genomic DNA by PCR using Advantage 2 Polymerase (#639202, Takara Bio, USA). Plasmid backbones were double-digested with the necessary restriction enzymes and purified using the Qiagen DNA purification kit (#28704X4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 50% fresh RPMI medium supplemented with 20 U/ml IL-2 and spin-fected on RetroNectin (Takara)-coated plates at 3000 g at 32°C for 2 h ...
-
bioRxiv - Physiology 2021Quote: ... 2 µL of the synthesized cDNA was mixed with SYBR Premix Ex Taq II (Takara Bio Inc.) and 0.4 µM primers (same as above ...
-
bioRxiv - Molecular Biology 2022Quote: ... the JAK3 open reading frame was amplified by PCR using the Advantage 2 polymerase mix (Takara Bio) with JAK3-ORF primers (Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... Make Your Own “Mate & Plate™” Library System and Yeast Transformation System 2 were purchased from TaKaRa. Synthetic-defined (SD ...
-
bioRxiv - Immunology 2021Quote: ... Synthesis of cDNA was performed by using 2 μg of total RNA with PrimeScriptTM Reverse Transcriptase (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Genomics 2019Quote: ... in a 20-μL reaction volume with 10 μL of 2× SYBR Premix Ex Taq II (TaKaRa), 2 μL of cDNA ...
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...
-
bioRxiv - Immunology 2021Quote: ... wild-type SARS-CoV-2 RBD was purified using a 5 mL HisTALON superflow cartridge (Takara Bio) followed by size exclusion chromatography using a Superdex 200 10/300 GL column pre-equilibrated in 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Immunology 2020Quote: ... the DNA-amplicons for Illumina sequencing were generated by using Advantage 2 PCR Kit (TAKARA Bio Europe), employing a mTCRβ reverse primer and a Universal primer mix (UPM) ...
-
bioRxiv - Bioengineering 2022Quote: ... Retrovirus was centrifuged for 2 hrs at 2560rcf at 320C onto wells pre-coated with RetroNectin (Takara). Wells were rinsed with PBS and CD8 T cells were added at 1×106 cells/mL in complete RPMI supplemented with 50 U/mL IL-2 and mouse T-activator Dynabeads (ThermoFisher ...
-
bioRxiv - Genomics 2022Quote: ... and 2 µl of the reaction was transformed into 25 µl of Stellar chemically competent bacteria (Takara). Plasmid minipreps were performed using the NucleoSpin Plasmid Transfection-grade Mini kit (Macherey-Nagel ...
-
bioRxiv - Immunology 2022Quote: ... The NTD domain was purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Genomics 2022Quote: ... and 2 µl of the reaction was transformed into 25 µl of Stellar chemically competent bacteria (Takara).
-
bioRxiv - Cell Biology 2022Quote: ... full-length GIP-2 cDNA with a C-terminal V5-His6 tag was inserted into pColdI (TAKARA) and used to inoculate rabbits and rats ...
-
bioRxiv - Cell Biology 2023Quote: ... Yeast 2-hybrid (Y2H) analysis was performed using the protocols described in the Yeast protocols handbook (Clontech, Protocol No ...
-
bioRxiv - Molecular Biology 2024Quote: ... Amplification was performed using the Advantage 2 Polymerase Mix (Clonetech, now Takara Bio USA, Mountain View, CA) and the following primers ...
-
bioRxiv - Bioengineering 2024Quote: ... Viral genome number was quantified by real-time PCR with AAVpro Titration Kit Ver.2 (Takara, 6233) according to manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2019Quote: 6His-GST-CRK2cyto and 6His-MBP-RBOHD/C constructs for recombinant proteins were generated by using In-Fusion technology (Clontech). The coding regions of CRK2cyto (WT ...
-
bioRxiv - Cell Biology 2020Quote: ... To detect the transgenic GFP-tagged Abl proteins we used anti-GFP (JL-8, 1:500 or 1:1000, Clontech). Anti-αTubulin (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... Then the homology arms and fluorescent protein sequences were assembled and cloned into the BamHI site of a pUC19 vector using Gibson assembly (Clontech). The primer sequences for the mGFP-EB1 ...
-
bioRxiv - Developmental Biology 2020Quote: Doxycycline-inducible overexpression of HA-tagged proteins was achieved using the Lenti-X Tet-On 3G Inducible Expression System (Clontech) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... as described previously (Keith et al., 2012, Freund et al., 2016) with plasmids encoding green fluorescent protein (GFP) (pEGFPN1; Clontech), mouse Kif11 (Myers and Baas ...
-
bioRxiv - Molecular Biology 2021Quote: Stable 3T3 cells (ATCC) overexpressing zDHHC3 or green fluorescent protein (GFP) as a control were generated using the pLVX lentiviral system (Clontech). Cells were labeled by stable isotope labeling with amino acids in cell culture (SILAC ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Genes of target prokaryotic proteins were amplified by PCR from corresponding genomic DNA and inserted into the pEGFP-C1 vector (Clontech). Mutated genes of prokaryotic proteins were obtained by PCR site-specific mutagenesis ...
-
bioRxiv - Microbiology 2020Quote: ... Total protein was extracted from 2,000 midguts using the lysis buffer supplied in the Capturem IP & Co-IP kit (Takara, 635721). The extracted proteins were divided into two equal parts and used for immunoprecipitation (IP) ...
-
bioRxiv - Biochemistry 2022Quote: ... The induction of His-and GST-fusion proteins and their subsequent purification using TALON® Metal Affinity Resin (Clontech Laboratories) and Glutathione SepharoseTM 4 Fast Flow beads (GE Healthcare) ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant His-tagged protein was purified from cell-free extracts using immobilised metal affinity chromatography (IMAC using Talon resin; Clontech) as described previously (34) ...
-
bioRxiv - Microbiology 2022Quote: ... Virus production was quantified by determining the amount of the Gag p24 protein using an enzyme-linked immunosorbent (ELISA) assay (Innogenetics or TaKaRa). For production of HIV-1 Env-pseudotyped viruses in Jurkat cells ...
-
bioRxiv - Plant Biology 2022Quote: ... The immunoprecipitated (RGA-GFP and RGAm2-GFP) and co-immunoprecipitated (IDD2-RFP) proteins were detected by western-blot with anti-GFP (JL8; Clontech) and anti- RFP (6G6 ...
-
bioRxiv - Cancer Biology 2020Quote: ... the TET protein expression in each clone was checked by immunoblotting using TetR monoclonal antibody (Clone 9G9) (Clontech, cat#631131). In addition ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pTAP-AFAP was constructed by cloning the gene fragment encoding AFAP-streptavidin-binding peptide-3xFLAG tag fusion protein (AFAP-SBP-3xFLAG, shorted as AFAP-SF) into mammalian expression vector pIRESpuro3 (Takara). SBP is a peptide with the length of 38 amino acids (Wilson et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cell debris was removed upon centrifugation and the proteins were purified from the supernatant by His-tag affinity chromatography using Ni-NTA agarose beads (Clontech). The bound proteins were washed with lysis buffer containing 10 mM imidazole and then eluted with lysis buffer containing 250 mM imidazole ...
-
bioRxiv - Biochemistry 2019Quote: ... The cell debris was removed upon centrifugation in a SS34 rotor at 4 °C (27,000 × g for 15 min) and the proteins were purified from the supernatant by His-tag affinity chromatography using Ni-NTA agarose beads (Clontech). The bound proteins were washed with lysis buffer containing 25 mM imidazole and then eluted with lysis buffer containing 500 mM imidazole ...
-
The Arabidopsis F-box protein FBW2 degrades AGO1 to avoid spurious loading of illegitimate small RNAbioRxiv - Cell Biology 2021Quote: ... Yeast transformation as well as yeast protein extraction were performed following the recommendations presented in the Yeast Protocol Handbook PT3024-1 (Clontech).