Labshake search
Citations for Takara Bio :
701 - 750 of 1325 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... NMuMG cells were cultured in DMEM supplemented with 10% FBS (Clontech #631367), 1 mM sodium pyruvate ...
-
bioRxiv - Cancer Biology 2022Quote: ... the viral supernatant was concentrated 10 times with Lenti-X concentrator (Takara). Media were changed at 24 hours after infection and antibiotics (2 μg/ml puromycin ...
-
bioRxiv - Cell Biology 2022Quote: ... concentrated down 10 times using the Lenti-X Concentrator (631232; Takara Bio). Supernatants were kept at −80°C prior to being directly applied to target cells which were subsequently spun at 700 xg for 1 h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 μL of EmeraldAmp® GT PCR Master Mix (Takara Bio, USA), 10 μM of each forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... The DNA samples (10 μg each) were digested with EcoRI (Takara Bio) and SalI (TOYOBO ...
-
bioRxiv - Microbiology 2023Quote: ... A middle-copy (~10-30 copies) episomal vector pGADT7 (Takara Bio Inc.) was used as the basic expression backbone for the introduction of chimeric proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... and concentrated 10-fold using Lenti-X concentrator (Takara Bio catalog: 631231). On the day prior to transduction ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 µL of premix WST-1 cell proliferation assay (Takara Bio, Inc.) was added to each well and the plate was incubated for an additional 2 hours ...
-
bioRxiv - Synthetic Biology 2022Quote: ... with 10 μg of total RNA treated with DNase I (Takara, Japan) and purified by G-50 column (GE Healthcare ...
-
bioRxiv - Genetics 2024Quote: ... PCR was performed as standard procedures in 10 μl reactions by TaKaRa Ex Taq ...
-
bioRxiv - Cancer Biology 2024Quote: ... and media was exchanged for DMEM with 10% Tet-free FBS (Clontech). Supernatants were collected and 0.45 μm filtered at 48 and 72 hours post-transfection and immediately used for infection of MeWo-rtTA target cells in the presence of 8 μg/ml of polybrene (Fisher) ...
-
bioRxiv - Plant Biology 2024Quote: ... and 10 μ L SYBR premium ExTaq Perfect Real Time (TaKaRa Bio), adjusted to a final volume of 20 μL with water ...
-
bioRxiv - Microbiology 2024Quote: ... 10 μl of 2x EmeraldAmp® GT PCR Master Mix (Takara Bio), 6 μl of ddH2O ...
-
bioRxiv - Immunology 2023Quote: ... 10 mM dNTPs (all reagents from TaKaRa Biotechnology Co., Ltd., Dalian, China), and 40 pmol of primer mix were added to a 50-μL reaction mixture ...
-
bioRxiv - Developmental Biology 2023Quote: ... 10 μl of TB Green® Advantage® qPCR Premix (Takara, #639676), and 50 nM of each primer adjusted to 20 µl with water ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was then pre- hybridized in 10 mL ExpressHyb (Clontech, NC9747391) at 44°C in a rotating oven for 1 hour ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10% tetracycline-free fetal bovine serum (FBS, TaKaRa Cat. #631368), 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Microbiology 2022Quote: ... The reaction mixture included 10 μL of SYBR Premix Ex Taq (TaKaRa), 0.4 μL of ROX reference dye (50× ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was applied on a Talon affinity column (10 ml; Clontech) equilibrated in buffer A ...
-
bioRxiv - Cancer Biology 2024Quote: ... animals were ad- ministered 10 mg/kg B/B homodimerizer (AP20187; Clontech) diluted in 4% ethanol ...
-
bioRxiv - Cancer Biology 2024Quote: ... the lentiviral supernatant was concentrated 10 times with Lenti-X concentrator (Takara). Media were changed at 24 hours after infection and antibiotics (2 µg/ml puromycin ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the beta-globin (HBB) 5’-UTR using the In-Fusion® HD Cloning Kit (Takara). The subsequent mutations in the TCRA and TCRB 3’-UTRs were generated using these initial constructs ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 Beta RBD was purified using a 5 mL HisTalon Superflow cartridge (Takara Bio) followed by buffer exchange into PBS using a HiPrep 26/10 desalting column (Cytiva).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 mL HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into 1x HBS-N buffer (Cytiva ...
-
bioRxiv - Cancer Biology 2020Quote: ... with 5 µg of pTetOne NTF2 (pDL66) and 100 ng of linear hygromycin marker (#631625, Clontech). After 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatants were applied to a chromatography column packed with 5 ml His60 superflow resin (Clontech) that had been equilibrated with buffer A (20 mM HEPES pH 7.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Molecular Biology 2020Quote: ... Antisense probes were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Performa Spin Columns (Edge BioSystems) ...
-
bioRxiv - Immunology 2021Quote: ... using the modified (Switching Mechanism At 5’ End of RNA Transcript) PCR cDNA synthesis protocol (Clontech) and oligonucleotides as described below (Table S3) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The obtained cDNA was subjected to 5’ RACE-PCR using SeqAmp DNA Polymerase (Takara Bio USA). Primers used for 5’ RACE-PCR and the number of PCR cycles are shown in Supplemental Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... the supernatant was loaded onto a 5 ml column of TALON® Metal Affinity Resin (TAKARA) equilibrated with Buffer A ...
-
bioRxiv - Genetics 2021Quote: ... was amplified from genomic DNA isolated from tail and peripheral blood using 1 µl of prepped DNA in 20 µl of PCR reaction containing 0.4 µl of PrimerStar GXL (TAKARA Bio, R050A), 4 µl of 5× Buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The first stranded cDNA was next amplified to produce double stranded cDNA in 20 amplification cycles by long distance PCR using the Advantage 2 polymerase mix (Takara, Clontech) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... the supernatant was removed and the pellet was dissolved in 20 ul RNase-free H2O (Takara Bio Inc., Otsu, Shiga, Japan). Quantitation of the RNAs was performed spectrophotometrically at 260 nm ...
-
bioRxiv - Microbiology 2020Quote: ... pH 6.9 with 0.4 mg/ml cysteine and 0.135 mg/ml ferric nitrate) under inducing conditions (by adding either 20 ng/mL or 40 ng/mL anhydrous tetracycline (aTC, Clontech #631310)) ...
-
bioRxiv - Microbiology 2020Quote: ... WEAU Env-pseudotyped viruses produced by 293F were concentrated 20-fold using Lenti-X concentrator (Clontech Laboratories, Inc. Mountain View, CA). Briefly ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNAs were PCR-amplified according to Takara’s SMART-Seq v4 protocol for 20 cycles using SeqAmp DNA Polymerase (Takara Bio, #638504) and a custom PCR primer ...
-
bioRxiv - Plant Biology 2020Quote: ... The qRT-PCR assay was performed using 1/20 diluted cDNA as templates in the reactions containing SYBR® Premix Ex TaqTM II (TaKaRa). The qRT-PCR assay was conducted in triplicate in an ABI 7500 Fast Real-Time PCR System ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μg of the total RNA from the leaves was reverse-transcribed for 30 min at 42°C in a 20-μl reaction volume using a High Fidelity PrimeScriptTM RT-PCR kit (Takara, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Add 25 mL 200 g/L glucose and 25 mL 20 g/L amino acid drop-out mix (Clontech. Inc., Japan) solution to prepare the medium] ...
-
bioRxiv - Microbiology 2023Quote: 0.35×105 293TT cells per plate were plated in 24-well plates 16-20 h prior to transfection of plasmids encoding HA-tagged CA Rab9a or the empty vector as control (Takara, 632105). 48 h after transfection ...