Labshake search
Citations for Takara Bio :
701 - 750 of 1161 citations for 7 Aminocarbonyl amino 4 hydroxy 3 4 4 sulfophenyl azo phenyl azo naphthalene 2 sulfonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Takara).
-
bioRxiv - Microbiology 2022Quote: ... A second construct for total gene deletion was generated by cloning the 5’ (843 bp) and 3’ (292 bp) homology regions amplified by PCR using a Taq DNA polymerase with proofreading activity (Takara) and primers P9 + P12 and P13 + P14 into the pL0001 vector (BEI Resources ...
-
bioRxiv - Microbiology 2022Quote: ... and McGee_sabB_rev (5’ atcgataagcgaattcttaataagcaaacacataattgagatacacgctataaagc 3’) and cloned into the pDYC40 plasmid that contains a kanamycin resistance cassette 55 via In-Fusion cloning (Takara). This plasmid is designed for complementation at a previously characterized ...
-
bioRxiv - Systems Biology 2022Quote: ... Optimized coding sequences were synthesized as gBlocks (Integrated DNA Technologies) carrying 16-base pair overhangs at the 5’ and 3’ ends to facilitate in-fusion cloning (Clontech) into pET expression vectors (EMD MIllipore).
-
bioRxiv - Genomics 2022Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described (Zhu et al. ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... magnanima was assessed by PCR amplifying a cifB-like gene (Extended Data Table 3) in the WOwHm-t76 region with the Emerald Amp Max Master mix (TaKaRa) at 94°C for 3 min ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was prepared from cortical samples from control and cKO animals (3 animals/group) by using RNAiso-plus kit (Takara) and according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adapter with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described previously 32 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Confirmatory “1-to-1” pairwise assays for selected interactants were performed with the MatchMaker Two-Hybrid System 3 (Clontech Inc.)
-
bioRxiv - Pathology 2020Quote: ... 3’-RACE-PCR was performed as per the instructions of SMARTer™ RACE-cDNA Amplification Kit User Manual (Clontech, 2012) using primers given in Table 1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The N-terminal 3X-FLAG-tagged ThPOK expression plasmid was generated by cloning the ThPOK coding DNA sequence (CDS) in the backbone of pEGFPC-3 (Clontech) plasmid after replacing the CDS of EGFP with 3X-FLAG ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Cell Biology 2019Quote: ... TRPV4(ΔPR)–myc and TRPV4(ΔAR1-3)–myc were constructed using PCR with template plasmids from Open Biosystems subcloned into pCMV-myc vector (Clontech) at the SalI/XhoI sites ...
-
bioRxiv - Plant Biology 2020Quote: ... Membrane blocking was performed with 3%BSA in PBS-t buffer for 1 h at room temperature followed by incubation with Mouse-anti-GFP (TaKaRa) (1/5,000 ...
-
bioRxiv - Plant Biology 2021Quote: ... MEL1 and lacZ) under distinct GAL4 upstream activating sequences as described in Matchmaker GAL4 Two-Hybrid System 3 & Libraries User Manual (Clontech). The transformants were grown on synthetic dropout (SD ...
-
bioRxiv - Genomics 2019Quote: SiGRF1 protein interactions were investigated by screening a foxtail millet cDNA library in yeast with the Matchmaker Two-Hybrid System 3 (Clontech). SiGRF1 cDNA without the termination codon was cloned with EcoR1 technology in pGBKT7 ...
-
bioRxiv - Plant Biology 2019Quote: Rapid amplification of 5’ cDNA ends (5’RACE) of CREF3 transcripts was performed using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA was generated through a 3’-RACE-Ready cDNA synthesis reaction using the SMARTer RACE cDNA amplification kit (Clontech), following the user manual ...
-
bioRxiv - Microbiology 2019Quote: ... A 500 ng of the RNA was used for the 5’RACE reaction with SMARTer RACE 5’/3’ kit (Clontech), according to manufacture’s instruction ...
-
Osh6 requires Ist2 for localization to the ER-PM contacts and efficient phosphatidylserine transportbioRxiv - Cell Biology 2020Quote: For testing protein-protein interactions Matchmaker™ GAL4 Two-Hybrid System 3 was used according to the manufacturer’s instructions (Clontech). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated by template-switch reverse transcription according to the SMARTer RACE 5’/3’ manual using the SMARTScribe Reverse Transcriptase (Takara) with a template-switch oligo including an 18-nucleotide unique molecular identifier (UMI) ...
-
bioRxiv - Immunology 2021Quote: ... 5′-GTGCATGCGGAAACACGTGTCTGG-3′ into pRRLU6-empty-gRNA-MND-Cas9-t2A-Puro vector or RNase L targeting gRNA 5′-GTTATCCTCGCAGCGATTGCGGGG-3′ into pRRLU6-empty-gRNA-MND-Cas9-t2A-Blast was achieved using the In-Fusion enzyme mix (Clontech). OAS1 and RNASEL KO 293T were generated using lentiviral transduction as described previously followed by selection in 2 μg/mL puromycin or blasticidin (Lau et al. ...
-
bioRxiv - Immunology 2020Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) using primers with specificity to IgM ...
-
bioRxiv - Molecular Biology 2020Quote: ... To purify the probes, 1/3 of the transcription reaction was loaded on a pre-spun (700xg, 5minutes) Chromaspin-100 column (Clontech) and centrifuged (700g ...
-
bioRxiv - Microbiology 2022Quote: ... 10 ng of linearized pDEST32 empty vector was co-transformed with 3 μl of PCR product to achieve recombinational cloning by gap-repair in Y2H Gold yeast strain (Clontech) expressing AD-fused CP204L (pPC86 vector) ...
-
bioRxiv - Cell Biology 2022Quote: ... a polymerase chain reaction using 5’-TCTAGAGCTACTAACTTCAGCCTGCTG-3’ / 5’ - CGGTGGATCCCCTTCTTCC-3’ primers on Ibidi USA 60101 LifeAct-GFPtag2 plasmid was cloned with In-Fusion HD enzyme kit (Takara) into the pLVX vector (Clontech ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2017) into the 3’ end of AQP1 in pBS-AQP1 (described above) using the In-Fusion Cloning system (Takara Bio) with the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... Full-length and N-terminally deleted versions of HaloTag-hCAP-H vectors were constructed by fusing the 3’ ends of the corresponding cDNAs with a HaloTag fragment using In-fusion HD Cloning Kit (TaKaRa). The following primers were used the construction of these HaloTag-hCAP-H vectors ...
-
bioRxiv - Microbiology 2022Quote: ... sacB was amplified using pAJF067 as a template and primers listed in Supplementary Table 3 and were cloned into pDB60 digested with EcoR1 using recombination based cloning (In-Fusion, Takara). For dinB2 and dinB3 overexpression plasmids constructs ...
-
bioRxiv - Microbiology 2022Quote: ... and 3′ sequences (3F) flanking the gene ORF were amplified from Ct3 genomic DNA by PrimeSTAR HS DNA polymerase (TaKaRa). The purified PCR products 5F and 3F were mixed with SalI-treated pBIG4MRHrev for In-Fusion reactions ...
-
bioRxiv - Immunology 2022Quote: ... Sequences encoding DCFHP (residues 1-1146 of HexaPro)2 and SΔC-Fer (residues 1-1143 as previously described)3 were cloned into the pADD2 vector backbone using HiFi PCR (Takara) followed by In-Fusion (Takara ...
-
bioRxiv - Neuroscience 2023Quote: The high-quality human total brain RNA that was used for 3’ RACE was purchased from Clontech (Mountain View, CA). SCA12 KI-10 and KI-80 mouse models were generated using the CRISPR/Cas9 approach by replacing the mouse PPP2R2B exon 2 with the human PPP2R2B exon 7 containing either 10 or 80 CAG triplets (Li and Margolis ...
-
bioRxiv - Synthetic Biology 2023Quote: Plant cDNA was prepared from 3 μg of each leaf RNA sample via RNA to cDNA EcoDry Premix (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The Kpn I – BamHI env fragments from the pSVIIIenv plasmids were cloned into the corresponding sites of pE7SB-NL4-3 using Long Ligase (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described (23) ...
-
bioRxiv - Microbiology 2023Quote: ... pAAV-UGI was constructed by cloning the entire coding sequence of UGI amplified from pBS-UGI-flag by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pAAV-ZsGreen1 (TaKaRa).
-
bioRxiv - Molecular Biology 2023Quote: ... linearized by PCR and using the divergent primers reported in Supplementary Table 3 and CloneAmp™ HiFi PCR Premix (Takara) polymerase ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was generated from 10 μl RNA according to the SMARTer RACE 5’/3’ manual using SMARTScribe Reverse Transcriptase (Takara) and a self-designed template-switch oligo (AGGGCAGTCAGTCGCAGNNNNWSNNNNWSNNNNWSGCrGrGrG) ...
-
bioRxiv - Microbiology 2023Quote: ... by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pRetroX-TRE3G (TaKaRa). pBS-UGI-flag was constructed by amplifying the UGI and flag sequence from UGI- pFERp44 by PCR and cloning it into the NotI and EcoRI sites of pBluescript II KS(+ ...
-
bioRxiv - Microbiology 2023Quote: ... The expression profile of target gene was evaluated using specific primers (Table-3) by using SYBR green RT-PCR master mix (Takara) in BioRad Real time PCR instrument ...
-
bioRxiv - Microbiology 2024Quote: ... and HHT1_U and HHT1_L for HHT1 (Table 3) using SYBR® Premix Ex TaqTM (Perfect Real Time) (Takara Bio Inc.) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... synthesized 5’ and 3’ fragments of the target RNA were 32P-radiolabeled at the 5’ end using T4 polynucleotide kinase (Takara). After gel purification ...
-
bioRxiv - Cancer Biology 2023Quote: ... and clonally isolated p53 KO cell lines were electroporated with 3 µg p53 firefly luciferase reporter plasmid pp53-TA-Luc (Clontech/Takara) and 0.3 ug renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Microbiology 2024Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described;86 (ii ...
-
bioRxiv - Molecular Biology 2024Quote: ... The expression vector was produced by inserting the cDNA encoding the Rhino fragment into pGEX-5X-3 (Cytiva) by Infusion (Takara). The primers used are listed in Supplementary Table 1.
-
bioRxiv - Microbiology 2024Quote: ... All 3 fragments were then ligated into pUC18T-mini-Tn7T digested with EcoRI and XmaI using the infusion kit (Takara). The deletion of bspD was complemented by cloning of a 2160 bp long sequence encoding bspD and its upstream region including eipA and its 5’ non-coding region harboring the CtrA-controlled promoter (22 ...
-
bioRxiv - Neuroscience 2020Quote: ... TetO/NGN2 gene expression was induced by Doxycycline (2 μg/mL; Clontech, Madison, WI) on day 0 ...
-
bioRxiv - Immunology 2022Quote: ... 2 μl of the pre-RT-PCR2 (PrimeScript™ II Reverse Transcriptase, Takara Bio) mix was added to each well ...