Labshake search
Citations for Takara Bio :
701 - 750 of 2832 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... (ii) addition of a second adapter on the 3’ end of the cDNA during reverse transcription using SmartScribe RT (Clontech Biotechnologies, Mountain View, CA) as previously described (63) ...
-
bioRxiv - Biochemistry 2019Quote: ... RACE-PCR was conducted with combination of fat body 3’RACE ready cDNA and RACE primers (Table S3) according to the manufacturer’s protocol (Takara Bio, Mountain View, CA, USA). The ORF was obtained by assembling the RACE fragment and the corresponding fragment obtained from the transcriptome ...
-
bioRxiv - Immunology 2020Quote: ... Virus concentration was estimated by p24 titration using the FLAQ assay76 (HIVGKO and VLPs) or the Lenti-X™ p24 Rapid Titer Kit (Clontech; HIVNL4-3/Luciferase).
-
bioRxiv - Developmental Biology 2020Quote: ... Lentiviral supernatant titers were determined by Lenti-X p24 Rapid Titer Kit (supplemental Table 3) according to manufacturer’s protocol (Takara Bio USA, Inc. California, U.S.A).
-
bioRxiv - Developmental Biology 2021Quote: PCR products were subcloned in frame with GFP sequence in 3′ into pCS2+-GFP vector using In-Fusion® HD Cloning Kit (Takara Bio USA, Inc.). For rescue experiments ...
-
bioRxiv - Neuroscience 2022Quote: Jacob-LMO4 interaction was reconfirmed using fusion vectors (bait vector pGBKT7, prey vector pGADT7) using MATCHMAKER Two-Hybrid System 3 (Takara Bio Europe/Clontech, France). Co-transformed yeasts were assayed for growth on quadruple drop-out medium (SD/–Ade/–His/–Leu/–Trp ...
-
bioRxiv - Cell Biology 2024Quote: ... Ten nanograms of RNA were used for preparing indexed libraries using SMARTer Stranded Total RNA-Seq Pico-Input Mammalian kit v.3 (Takara Bio. Cat# SKU: 634487) as per manufacturer’s instructions (except that fragmentation was performed for 3 minutes of fragmentation at 94 °C and 13 cycles was used for PCR2) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reactions at every examined depth were performed in triplicate (n=3) using Takara SpeedSTAR HS DNA polymerase kit (Takara Bio USA, Madison, WI) with the following modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random 6 primers (TAKARA BIO). Thereafter ...
-
bioRxiv - Developmental Biology 2020Quote: ... was cloned into pLVX Tet-One Puro plasmid (Clontech), packaged in 293T cells (from ATCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... in a Mupid-One gel electrophoresis system (TaKaRa, Japan). RNA samples were purified for the second time by the TRIzol method as mentioned above and were stored at −80°C until further analysis.
-
bioRxiv - Evolutionary Biology 2023Quote: ... A total of 500 ng of sheared DNAs was input for methyl-CpG binding domain (MBD) enrichment using the EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of extracted RNA was subjected to one-step real-time RT-PCR using a One Step PrimeScript™ RT-PCR Kit (Perfect Real Time) (TaKaRa Bio Inc.) on a QuantStudio 5 Real-Time PCR system (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The extracted RNAs were subjected to one-step real-time PCR using the One Step PrimeScript™ RT-PCR Kit (Perfect Real Time) (TaKaRa Bio Inc.).
-
bioRxiv - Plant Biology 2023Quote: ... The yeast two-hybrid and one-to-one confirmation experiments were performed according to Matchmaker™ Gold Yeast Two-Hybrid System User Manual (Clontech, https://www.clontech.com/). Primers for vector construction were listed in Table S8.
-
bioRxiv - Neuroscience 2023Quote: ... anti-GFP (Clontech, JL-8, 1:10,000 in 5% non-fat milk) and anti-GAPDH (Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression level of Venus and Venus-tagged arrestin-3 proteins was determined with anti-GFP JL-8 antibody (#632381, Takara Bio USA, San Jose, CA). The endogenous β-actin (loading control ...
-
bioRxiv - Microbiology 2020Quote: ... HSV-1 was pretreated with 2 μg/ml DNase (Takara, Japan), and then diluted to MOI=20 ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Neuroscience 2024Quote: ... After the addition of 5 µl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) to the cap ...
-
bioRxiv - Neuroscience 2020Quote: ... we combined 494 μL of internal solution with 6 μL of recombinant RNase inhibitor (1 U/μL, Takara) in order to increase RNA yield ...
-
bioRxiv - Microbiology 2022Quote: RT-PCR was performed in a single closed tube using a one-step RT-PCR kit (One Step PrimeScript III RT-qPCR Mix, with UNG; Takara Bio Inc., Kusatsu, Japan) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were treated with 100ug/mL hygromycin B (Takara bio 631309). Cells were exposed to 100ug/mL hygromycin B for 8 days ...
-
bioRxiv - Immunology 2020Quote: ... plates were coated with 40 μg/mL retronectin (TAKARA, # T100A/B) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The One-step PrimeScript miRNA cDNA Synthesis Kit (Takara, Japan) was utilized for reverse transcription ...
-
bioRxiv - Systems Biology 2019Quote: ... Lenti-X™ Tet-One™ Inducible Expression System (Clontech) was used ...
-
bioRxiv - Developmental Biology 2020Quote: ... PrimeScript II High Fidelity One step RT-PCR Kit (Takara) was used with the following primers ...
-
bioRxiv - Pathology 2020Quote: The viral loads of WHCV in BALF of patient 1 were determined by quantitative real-time RT-PCR with Takara One Step PrimeScript™ RT-PCR Kit (Takara RR064A) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 μl lysis buffer per well (1:20 RNase inhibitor (Clontech) in 0.2% (v/v ...
-
bioRxiv - Immunology 2022Quote: ... The SMARTer Mouse TCR a/b Profiling Kit (Takara, Cat. No. 634403) was used to amplify both TCRα and TCRβ sequences ...
-
bioRxiv - Microbiology 2021Quote: ... One-Step TB Green PrimeScript PLUS RT-PCR Kit (Takara Bio) was used under the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... with the high-fidelity One Step RT-PCR Kit (Takara Bio). PCR products were gel purified and cloned into the pCR4-TOPO vector using the Zero Blunt Topo Cloning Kit (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were grown one more day in NDiff 227 media (Takara) supplemented with 1 µM PDO325901 and 3 µM CHIR99021 (NDiff + 2i) ...
-
bioRxiv - Biochemistry 2021Quote: ... One-step PrimeScript™ RT Reagent Kit (Takara, Japan, Cat.#RR064A) Kit were used for quantitative real-time PCR ...
-
bioRxiv - Microbiology 2020Quote: ... One step TB green Primescript RT-PCR kit II (Takara, RR086B) was used for qPCR reaction on Quantstudio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... pombe genome using KOD One DNA polymerase (TaKaRa Bio Inc., Japan). The first PCR products were used as primers in the second PCR step to amplify a cassette for integration ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfection medium was replaced with 2 ml of reduced serum culture medium (5% FCS) supplemented with 300 μM A/C heterodimerization agent (formerly AP21967, Takara BioInc), 20 mM HEPES and 10 μM cholesterol (balanced with methyl-β-cyclodextrin ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Biochemistry 2019Quote: Hexa-histidine-tagged scaffolding protein (6 mg) was loaded on a 1 ml immobilized metal affinity chromatography column charged with cobalt (Clontech). Coat protein monomers (0.2 mg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.125 μl Takara Ex Taq DNA Polymerase (5 U μl-1) (TaKaRa, Shiga, Japan), 2 μl of DNA and 15.67 μl nuclease-free water ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of cDNA was amplified using Advantage HF 2 DNA polymerase (Takara) for 25-30 cycles according to the manufacturer’s instructions (Fw 5’-GGGATTAAAGGTTTATACCTTCCC-3’ and Rv 5’-TCGTTGAAACCAGGGACAAG-3’) ...
-
bioRxiv - Microbiology 2023Quote: ... and MS4 (feline B-cell lymphoma) (73) using an RNAiso Plus kit (Takara), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...