Labshake search
Citations for Takara Bio :
701 - 750 of 2262 citations for 6 Chloropyrazolo 1 5 a pyridine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 µM of Shield-1 peptide (Clontech, Mountain View CA) for 4-6 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μM of Shield-1 peptide (Clontech, Mountain View CA) for 4 h ...
-
bioRxiv - Molecular Biology 2024Quote: - IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Molecular Biology 2024Quote: IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Developmental Biology 2020Quote: ... and mCherry were isolated by PCR from various templates and inserted into the pGL4.23-(C120×5)-TATA vector with In-Fusion cloning (Clontech) according to manufacturer instructions using a 1:2 vector-to-insert ratio to generate optogenetic response plasmids ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR reaction mixture (10 μl total volume) included 5 μl SYBR Premix Ex Taq II (TaKaRa, Dalian, China), 3.5 μl ddH2O ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’-RACE and 3’-RACE reactions were performed with the Smart RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’ end regions of MIC14 and MIC15 were amplified using the SMART RACE cDNA Amplification Kit (Clontech BD) using total or poly(A)+tachyzoite RNA (strain RH ...
-
bioRxiv - Molecular Biology 2022Quote: ... bound RNAs were eluted via 30min incubation at 55°C in wash buffer supplemented with 0.5 μg/μL Proteinase K and 0.1% SDS and isolated using Qiazol/chloroform separation and NucleoSpin RNA columns (Takara). Luciferase control RNA is spiked in to each sample (5ng/sample ...
-
bioRxiv - Immunology 2022Quote: The sequence of anti-IFNγ was cloned from XMG1.2 hybridoma (ATCC) using SMARTer RACE 5’/3’ kit (Takara Bio). The 6xHis tagged anti-Dsg ...
-
bioRxiv - Cell Biology 2019Quote: pLL6-MYH12A construct was made by replacing 5’LTR promoter in pLL5.0 (Cai et al., 2008) with PTight promoter from pTRE-Tight Vector (Clontech) and inserting human MYH12A using EcoRI-BamHI cloning sites ...
-
bioRxiv - Biochemistry 2021Quote: ... prepared as described above was mixed with imidazole (5 mM) and 0.5 mL of Talon superflow metal affinity resin (Clontech) that had been equilibrated with buffer (as above for magnetic agarose) ...
-
bioRxiv - Microbiology 2021Quote: PDGFRβ-targeted sgRNA (5’-CCGGTGAGAGCCACCCTGACAGTG-3’) was cloned into the pGuide-it-ZsGreen1 vector (Takara, Biomedical Technology, Beijing, China). This plasmid could simultaneously express Cas9 ...
-
bioRxiv - Genomics 2022Quote: ... IgG and IgM 5’RACE AIRR-seq libraries were generated using the SMARTer Human BCR Profiling Kit (Takara Bio), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were maintained at 37 °C in a humidified atmosphere at 5% CO2 in DMEM 4.5g/L Glucose with UltraGlutamine media supplemented with 10% of Tet-free FBS (Clontech) and 1% penicillin/streptomycin.
-
bioRxiv - Cell Biology 2019Quote: ... a pFA6a-3’UTR-AfeI-5’UTR-scd2-kanMX-3’UTR (pSM2255) plasmid was generated by InFusion cloning (Clontech) of a pFA6a-based plasmid containing the yeast kanMX resistance cassette digested with KpnI and AscI ...
-
bioRxiv - Immunology 2021Quote: ... The supernatants were collected and applied to a column filled with 5 ml of TALON Metal Affinity resin (Takara) previously equilibrated with ice-cold PBS ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The template plasmid for the mCherry-targeting ssDNA was constructed with 1.5 kb long 5’ and 3’ arms amplified from the C57BL/6N genome using PrimeSTAR GXL DNA Polymerase (TaKaRa), the upstream genome sequence of the stop codon of Rtl5 and downstream of the predictive cut site by Cas9 ...
-
bioRxiv - Microbiology 2020Quote: 5’-RACE analysis was performed using SMARTer RACE 5’/3’ kit and In-Fusion HD Cloning kit according to the manufacturer’s instructions with slight modifications (Clontech). 5’-RACE ready cDNA was synthesized from purified mRNA (TG ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’ UTR and EGFPd2 sequences were cloned in the multiple cloning site of pTet-One vector (Takara-Clontech, 634301). DG NSC Droshafl/fl cells were brought in suspension by incubating with 0.25% trypsin (Gibco #15090 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’ UTR and EGFPd2 sequences were cloned in the multiple cloning site of pTet-One vector (Takara-Clontech, 634301). DG NSC Droshafl/fl cells were brought in suspension by incubating with 0.25% trypsin (Gibco #15090 ...
-
bioRxiv - Plant Biology 2022Quote: CRISIS2 or Nb14-3-3 was fused with the Gal4 DNA binding domain in pGBKT7 (Clontech, PT3248-5, USA) and inserted into the Saccharomyces cerevisiae Y2HGold strain (Clontech ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μl of the reaction mixture was prepared with 5 μl of SapphireAmp Fast PCR Master Mix (Takara #RR350B), 1 μl of each of forward and reverse primers (final concentration 0.2 μM) ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... The plasmid for mCherry insertion was constructed with 1.5 kb long 5’ and 3’ arms amplified from the C57BL/6N genome using PrimeSTAR GXL DNA Polymerase (TaKaRa). The 5’ arm is the genomic sequence upstream of the stop codon of Rtl9 and the 3’ arm is downstream of the predictive Cas9 cut site ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription of mRNA was performed using 3-5 μg RNA with RNA to cDNA EcoDry Premix (Takara, #639549). For real-time PCR analysis ...
-
bioRxiv - Plant Biology 2023Quote: ... and SD4 (-Trp-Leu-His-Ade) media at 30℃ for 3–5 d according to the manufacturer’s manual (Clontech).
-
bioRxiv - Neuroscience 2023Quote: ... A total of 100 microglia from each region were collected in 5 μL single-cell lysis buffer (635013, Takara), and flash-frozen on dry ice.
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR analysis was then performed with 1.0 μl of 5-fold diluted cDNA using a SYBR premixed Ex Taq kit (Takara), and a Light Cycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV was purified 3–5 days after transfection using AAVpro Purification Kit Midi or Maxi (Takara Bio, Shiga, Japan). The viral concentration was measured by qRT-PCR.
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was amplified from WT genomic DNA by PCR using Advantage 2 Polymerase (#639202, Takara Bio, USA). Plasmid backbones were double-digested with the necessary restriction enzymes and purified using the Qiagen DNA purification kit (#28704X4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 50% fresh RPMI medium supplemented with 20 U/ml IL-2 and spin-fected on RetroNectin (Takara)-coated plates at 3000 g at 32°C for 2 h ...
-
bioRxiv - Physiology 2021Quote: ... 2 µL of the synthesized cDNA was mixed with SYBR Premix Ex Taq II (Takara Bio Inc.) and 0.4 µM primers (same as above ...
-
bioRxiv - Molecular Biology 2022Quote: ... the JAK3 open reading frame was amplified by PCR using the Advantage 2 polymerase mix (Takara Bio) with JAK3-ORF primers (Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... Make Your Own “Mate & Plate™” Library System and Yeast Transformation System 2 were purchased from TaKaRa. Synthetic-defined (SD ...
-
bioRxiv - Immunology 2021Quote: ... Synthesis of cDNA was performed by using 2 μg of total RNA with PrimeScriptTM Reverse Transcriptase (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... in a 20-μL reaction volume with 10 μL of 2× SYBR Premix Ex Taq II (TaKaRa), 2 μL of cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...
-
bioRxiv - Immunology 2020Quote: ... the DNA-amplicons for Illumina sequencing were generated by using Advantage 2 PCR Kit (TAKARA Bio Europe), employing a mTCRβ reverse primer and a Universal primer mix (UPM) ...
-
bioRxiv - Bioengineering 2022Quote: ... Retrovirus was centrifuged for 2 hrs at 2560rcf at 320C onto wells pre-coated with RetroNectin (Takara). Wells were rinsed with PBS and CD8 T cells were added at 1×106 cells/mL in complete RPMI supplemented with 50 U/mL IL-2 and mouse T-activator Dynabeads (ThermoFisher ...
-
bioRxiv - Genomics 2022Quote: ... and 2 µl of the reaction was transformed into 25 µl of Stellar chemically competent bacteria (Takara). Plasmid minipreps were performed using the NucleoSpin Plasmid Transfection-grade Mini kit (Macherey-Nagel ...
-
bioRxiv - Immunology 2022Quote: ... The NTD domain was purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Genomics 2022Quote: ... and 2 µl of the reaction was transformed into 25 µl of Stellar chemically competent bacteria (Takara).
-
bioRxiv - Cell Biology 2022Quote: ... full-length GIP-2 cDNA with a C-terminal V5-His6 tag was inserted into pColdI (TAKARA) and used to inoculate rabbits and rats ...
-
bioRxiv - Biochemistry 2023Quote: ... The virus particles were further concentrated at 10X in volume using Lenti-X-concentrator (Clontech, PT4421-2) according to the manufacturer’s protocol ...