Labshake search
Citations for Takara Bio :
701 - 750 of 778 citations for 6 Hydroxymethyl 4 methoxy 5 methyl nicotinic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: First-strand cDNA was synthesized from 5 μg of total RNA using the PrimeScriptTMII cDNA Synthesis kit from Takara (https://takara.com/). The full-length cDNAs of SUH1 and BC10 were amplified using the Taq LA DNA polymerase PCR kit from Takara (https://takara.com/ ...
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid and cloned within exon 4 (between base 43-44) and exon 5 (between base 71-72) of the circ-HDGFRP3 sequence by In-Fusion Cloning Kit (Takara Bio) to obtain the final constructs p-circ-Ex4 and p-circ-Ex5.
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of a 1:5 cDNA dilution was used together with forward and reverse primers per each mRNA (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of cDNA was used together with specific forward and reverse primers for primary miR-43093 (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Plant Biology 2024Quote: ... The coding sequences (CDS) of the full length and truncated Sr62NLR were cloned into pGADT-7 vector (Clontech, USA, PT3249-5) with the sites EcoRI and BamHI ...
-
bioRxiv - Immunology 2024Quote: ... containing 0.5 ml of a 1:1 solution of phosphate-buffered saline (PBS):FBS supplemented with ribonuclease inhibitor (1:100; Takara Bio). For some samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... reverse primer 5-TACCAAACTCTCAATTGCTC-3’) and the presence of small insertions and deletions assessed with the Guide-it Mutation Detection Kit (Takara Bio). The PCR amplicons were then inserted into pGEM vectors using the pGEM-T Easy Vector system (Promega ...
-
bioRxiv - Systems Biology 2020Quote: ... full length double stranded cDNA (dscDNA) was generated using the SMART-Seq version 4 Ultra Low Input kit (Takara Bio USA, Mountain View, CA) and the Nextera XT DNA Library Preparation kit (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... NK cells were transduced on day 4 of culture using transiently produced replication incompetent RD114 pseudotyped retroviral particles immobilized on RetroNectin (Clontech Laborotories, Palo Alto, CA).
-
bioRxiv - Molecular Biology 2022Quote: ... Section B step 4 in the protocol was modified to account for the incorporation of UDIs (Takara SMARTer RNA Unique Dual Index Kit-96A). A total of 2 uL of each UDI was used instead of the recommended 1 uL each of the 5’ and 3’ PCR primers ...
-
bioRxiv - Evolutionary Biology 2023Quote: SARS-CoV-2 cDNA was generated from 100 ng of RNA in a RT-PCR reaction buffer containing 4 μL of 5X PrimeScript IV 1st strand cDNA Synthesis Mix (Takara Bio, Kusatsu, Shiga, Japan), 2 μL of 50 μM random hexamer primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were blocked as above and then incubated overnight at 4 °C with appropriate antibodies to GFP (1:1000 dilution; Clontech, Catalog No. 1. 632381) and tubulin α (1:2000 dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... Overnight primary antibody incubation was done at 4°C with one or more of the following antibodies in blocking buffer: rabbit anti-DsRed (Takara Bio, 632496, 1:500), goat anti-mCherry (Sicgen ...
-
bioRxiv - Microbiology 2020Quote: ... 250 ng of RNA isolated from each condition was converted into cDNA and processed through the SMARTer® 5’/3’ RACE Kit (Takara Bio) for 5’-RACE following manufacturer protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pdum-Lox2 and Avi-Post2 the SMART™ (Switching Mechanism At 5’ end of the RNA Transcript) RACE method (SMART™ RACE cDNA amplification kit, Clontech) was used (Brena et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... templates were constructed by cloning the 2 kb 5’ and 3’ homology arms into pPD95.77 plasmids using In-Fusion Advantage PCR cloning kit (Clontech, cat. no. 639621). We used the CRISPR design tool (http://crispr.mit.edu ...
-
bioRxiv - Immunology 2021Quote: TCR cDNA libraries for high-throughput sequencing were prepared by 5’rapid amplification of cDNA ends (RACE) using the SMARTScribe™ Reverse Transcriptase (Clontech, USA) as previously described (39 ...
-
bioRxiv - Neuroscience 2021Quote: ... ESCs were seeded at 1 × 105 cells per well and maintained at 37°C in 5% CO2 under humidified conditions with a 3i culture medium (Y40010, Takara Bio, Japan) without feeder cells ...
-
bioRxiv - Biochemistry 2020Quote: Complementary DNA (cDNA) was generated from previously extracted total RNA (900 ng) using the SMARTER RACE 5’/3’ kit (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... RNC 82-aa C34A with [SG]5 or [SG]10 repeats were constructed by the Prime STAR MAX (Takara Bio Inc., Japan) method using appropriate primers (Table 1).
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... Single colonies grown on selection plates were inoculated in 5 ml of SD-Leu-Trp overnight at 28 °C (ST0047, Takara Bio, USA). Saturated culture was then used to make serial dilutions of OD600 1 ...
-
bioRxiv - Microbiology 2020Quote: ... 30 sec polymerase activation at 98 °C followed by 30 cycles of 15 sec denaturing at 98 °C and 5 min annealing and extension at 65 °C (or variable values in gradient mode) in Thermal Cycler Dice ® (Takara Bio). The PCR products in Pool 1 and 2 reactions for same clinical samples were combined and purified with 1X concentration of AmpureXP.
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... at 30°C for 3-5 days and assayed for growth on the SD/-Trp/-Leu/-His/-Ade/X-α-gal plates (TaKaRa Bio). Each experiment was repeated at least three times.
-
bioRxiv - Cell Biology 2021Quote: 5’ and 3’ RACE reactions were performed to isolate full-length lncEry from the total RNA of MEP cells using the 5’- and 3’-Full RACE Kits (TaKaRa, Dalian, China) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 40 μL nematode liquid was transferred to a 1.5-mL Eppendorf tube with 40 μL of nematode lysis solution (Zhang et al., 2017) and 5 μL of protease K (Takara, Dalian, China). The mixture was then subjected to centrifugation at 2,000 ×g for 1 min before heating for 45 min at 65 °C in a constant temperature water bath ...
-
bioRxiv - Cell Biology 2021Quote: ... 5-AAC TTC GCG CTT CCT AAG TCC CCG AAG GA-3 using Prime STAR mutagenesis kit (Takara Bio Inc. Shiga, Japan). GFP-Rab27a was purchased from RikenBRC(Tsukuba ...
-
bioRxiv - Genetics 2020Quote: ... The 5’ and 3’ end of the viral genome was amplified by rapid amplification of cDNA ends by using the 5’ and 3’ Smarter RACE kit (TaKaRa, Dalian, China).
-
bioRxiv - Genetics 2020Quote: 5’ leader repeat lines were generated by cloning the same 28 repeat sequence described above with approximately 30nt on either side of intronic sequence into the 5’UTR of pEGFP-N1 (Takara Bio USA) in the 0+ reading frame ...
-
bioRxiv - Plant Biology 2022Quote: ... Cytosolic domain fragments of NbPMA3 (F1, F2 or F3) were fused with the Gal4 activation domain in pGADT7 (Clontech, PT3249-5, USA) and inserted into the Y187 strain under selection with SD/-Leu ...
-
bioRxiv - Immunology 2022Quote: Extracted RNA was thawed on ice and converted to first strand complementary DNA (cDNA) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA), as described by the manufacturer and a custom oligonucleotide that contained the template switch oligo and a unique molecular identifier (5’ TSO-UMI ...
-
bioRxiv - Plant Biology 2022Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB93 using Taq polymerase (Takara Bio Inc. Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... ESCs were seeded at 1 × 105 cells per well and maintained on the dishes at 37°C in 5% CO2 under humidified conditions with a 3i culture medium (Y40010, Takara Bio, Japan) without feeder cells ...
-
bioRxiv - Neuroscience 2024Quote: ... was amplified by PCR and inserted into the Cre-dependent AAV hSyn FLEx vector using BamHI/KpnI restriction sites.pTet-on (transactivator) was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pmCherry was generated by fusing the lacI-Ptrc inducible system and mCherry into the vector pBBR1MCS-5 using In-Fusion® Snap Assembly Master Mix (Takara Bio). All plasmids were extracted using QIAprep® Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Physiology 2022Quote: ... A total of 5 μg of each protein was subjected to trypsin treatment using a captured trypsin column (TAKARA, 635722, Shiga, Japan). After trypsin treatment ...
-
bioRxiv - Plant Biology 2023Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB50 using Taq polymerase (Takara Bio Inc., Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA libraries from 5 ng total RNA were prepared using the SMARTer® Stranded Total RNA-Seq Kit (Takara Bio USA, #635005), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 mM DTT) supplemented with Pierce Protease Inhibitors EDTA-free (PIA32955) and Pierce Phosphatase Inhibitors (PIA32957) and RNase inhibitor (TaKaRa, cat# 2313A), and harvested by scraping ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5% SDS and supplemented with Pierce Protease Inhibitors EDTA-free (PIA32955) and Pierce Phosphatase Inhibitors (PIA32957) and RNase inhibitor (TaKaRa, cat# 2313A) and 1 mM DTT ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.5 μl used as a source of genomic DNA in 20 μl PCRs with PrimeStar Hot Start DNA polymerase (Takara Bio, R010A). The amplified DNA was subcloned with StrataClone Blunt PCR cloning kit (Agilent Technologies ...
-
bioRxiv - Bioengineering 2024Quote: ... to a final concentration of 5 µg/mL and 2 µg/mL doxycycline (631311, Takara Bio USA, Inc., Mountain View, CA, USA) for the first 7 days after seeding ...
-
bioRxiv - Developmental Biology 2024Quote: ... and RNA oligonucleotide adaptors were sequentially ligated to the 3’ and 5’ ends of small RNA by T4 RNA ligase (Takara, Dalian, China). cDNA synthesis was performed using oligo (dT ...
-
bioRxiv - Microbiology 2020Quote: ... using each of the following 4 restriction enzymes: HaeIII or Hha I or Rsa I or Alu I (10 units, Takara Bio Co. Ltd. Shiga, Japan) in buffer solution (10xLow salt buffer ...
-
bioRxiv - Microbiology 2021Quote: 5’-RACE PCR was performed on total RNA from VSVg-NL43 infected CD4+ T cells and MDMs following the manufacturer’s protocol for SMARTer® RACE 5’/3’ Kit (Takara Bio, Cat: 634858). Random primers were annealed to template RNA using 10X Random Primer Mix ...
-
bioRxiv - Developmental Biology 2022Quote: ... and an extra 15 bp at the 3’ and 5’ ends allowing their insertion into the linearized NheI-PacI pUASt-5C plasmid using In-Fusion cloning strategy (Takara Bio USA, Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... 1.0~5 μg of total RNA was reverse-transcribed in a 20-μl reaction containing 1x RT buffer (Clontech, Mountain View, CA, USA), 0.5 mM dNTPs ...
-
bioRxiv - Microbiology 2021Quote: ... the cDNAs were reverse-transcribed from 5 µg of total RNA with the PrimeScript™ II 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China). Real time PCR (qPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Single cells were collected into individual wells of 96 well-PCR plates containing 9.5 μL/well of freshly made lysis buffer (provided in SMART-Seq v4 Ultra Low Input kit for Sequencing (Takara Bio USA #634893)) ...