Labshake search
Citations for Takara Bio :
651 - 700 of 761 citations for VEGF C Human 196a.a HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... for 24 h and transduced with lentiviral particles by spinfection (1000 x g for 90 min at 32°C) in the presence of Polybrene (5 μg/ml) on the plates coated with Retronectin (50 μg/ml) (Takara/Clontech) and anti-CD3 (1–2 μg/ml) ...
-
bioRxiv - Biophysics 2020Quote: ... 6xHis-tagged protein fraction was incubated for thirty minutes at 4°C with Talon resin (Clontech Laboratories/Takara Bio USA) that had been previously equilibrated in lysis/extraction buffer ...
-
bioRxiv - Biophysics 2020Quote: ... 6xHis-tagged protein fraction was incubated for thirty minutes at 4°C with Talon resin (Clontech Laboratories/Takara Bio USA) that had been previously equilibrated in lysis/extraction buffer ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were subcloned into a pcDNA3.1 vector for mammalian expression and a C-terminal HA-tag (YPYDVPDYA) was add using In-Fusion HD Cloning technology (Clontech). A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech ...
-
bioRxiv - Microbiology 2020Quote: ... fused to GFP was generated by subcloning from pEPI-GFP-UL44425-433 (42, 43) into the pEGFP-C1 vector C-terminal to GFP (Clontech). Constructs to express full-length or truncated EBOV-VP24 protein fused to GFP or GFP-UL44NLS were generated by PCR amplification from pCAGGS-FLAG-VP24 (kindly provided by C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the manufacturer specifically states they should not occur in RNA-Seq reads if used in combination with the Nextera XT DNA library preparation kit (Appendix C in SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing User Manual, Takara Bio Inc ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR fragments containing M1 Spastin amino acids 197-328 was inserted into the C-terminus of FP-M11-92 linearized by BamHI enzyme using In-Fusion cloning kit (Takara). DsRed-M11-92-197-328 was constructed by replacing mApple in mApple-M11-92-197-328 with DsRed2 using NheI and EcoRI restriction sites ...
-
bioRxiv - Neuroscience 2019Quote: ... In situ hybridization was followed by incubation at 4°C overnight with a rabbit anti-dsRed (1:3000, Clontech: 632475) primary antibody ...
-
bioRxiv - Biophysics 2020Quote: ... containing either tetra-acetylated or unmodified histone H4 was digested for 5 min at 22 °C with micrococcal nuclease (MNase) (0.125 to 2.0 units; Takara, cat. #2910A) in 5.5 mM Tris-HCl buffer (pH 7.6 ...
-
bioRxiv - Microbiology 2021Quote: Expression plasmids encoding for human ZMPSTE24 with and without a C-terminal FLAG-tag or HA-tag were PCR amplified and subcloned into the pQXCIP (Clontech) backbone using flanking restriction sites AgeI and BamHI ...
-
bioRxiv - Biochemistry 2020Quote: ... siRNA resistant WRN transgenes containing a C-terminal 3xFLAG tag (designated WRNr) were synthesized and inserted into the lentiviral pLVX-IRES-puro plasmid vector (ClonTech) at GenScript ...
-
bioRxiv - Bioengineering 2022Quote: ... The solution was heated at 65°C for 5 minutes using Takara® PCR Thermal Cycler (Takara Corp., Shiga, Japan), and then gradually cooled down to 30°C over a time span of 10 minutes before settling down to 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... Sequences encoding DCFHP (residues 1-1146 of HexaPro)2 and SΔC-Fer (residues 1-1143 as previously described)3 were cloned into the pADD2 vector backbone using HiFi PCR (Takara) followed by In-Fusion (Takara ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μL of reaction was added to 50 μL Stellar Competent cells on ice for 30 mins followed by 45 second heat shock at 42 degrees C and resuspended in 500 μL SOC medium (Takara) and placed 1 hour shaking 200 rpm at 30 degrees C ...
-
bioRxiv - Neuroscience 2023Quote: ... The non-solubilized fraction was separated by centrifugation at 47850 x g for 1 h at 4 °C and 4 mL of cobalt-charged TALON resin (Clontech, Takara) was added to the solubilized fraction for batch binding (3 h at 4 °C) ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Bioengineering 2022Quote: ... Sections were incubated overnight at 4°C in primary antibody diluted in PBS (1:100 monoclonal mouse anti-GFP; 632380, Clontech). After washing with PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4×106 B cells per well were plated in 2 mL on 6-well plates that had been coated with RetroNectin (25 μg/mL, 4°C, overnight; #T100B, Takara), blocked with 2% BSA in PBS (1h ...
-
bioRxiv - Biophysics 2022Quote: ... These plasmids were designed by fusing the coding sequences of the respective proteins C-terminal (intracellularly) via a linker to mEGFP (called D0 / Donor only) or mCherry in the pIRESpuro2 vector (Clontech)32 (for more linker details see Supplementary Table 5) ...
-
bioRxiv - Immunology 2023Quote: ... cells were harvested and resuspended in retroviral supernatant and centrifuged for 90 minutes at 1000g at 32°C on retronectin (TaKaRa) coated plates.
-
bioRxiv - Neuroscience 2023Quote: ... inserting an in-frame 15bp flexible linker sequence (encoding the amino acids GGGGA) followed by EGFP at the C-terminus using Infusion cloning (Clontech). For the Tg(NBT:ap2s1-gfp ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... BBQ and FICZ as indicated at 37°C in 96-well plates for 5 days prior to measuring viability using WST reagent (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were incubated overnight at 4°C with primary antibody diluted in blocking buffer (these were: 1:200 Living Colors Ab, #632380, Takara; 1:100 L-plastin ...
-
bioRxiv - Molecular Biology 2023Quote: ... and ORF66-TurboID were subcloned into the BamHI and NotI sites of pcDNA4 3xHA (C-term) using InFusion cloning (Clontech). TurboID-ORF34 was subcloned into the NotI and XhoI sites of N-term 3xHA pcDNA4 ...
-
bioRxiv - Plant Biology 2023Quote: ... transferred membranes were hybridized overnight at 4 °C with the following primary antibodies: anti-GFP (Takara Bio Cat# 632381, RRID:AB_2313808) (1/5000) ...
-
bioRxiv - Biochemistry 2023Quote: The full-length SKP1-FBXO22 fusion protein with a 3xGGGS-linker was cloned into a pNic-Bio2 vector that encodes for an N-terminal His-tag as well as a C-terminal Avi-tag (GenBank: JF912191) using an In-Fusion HD Cloning System kit (Takara), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... cells were resuspended in Trizol reagent and frozen at -20°C until RNA was extracted using the Macherey-Nagel Nucleospin RNA XS Kit (CAS: 740902.50, Takara Bio) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were seeded as described above and treated for 24 h with 500 nM Rapalog A/C hetero-dimerizer (Takara). Cells were collected as described above ...
-
bioRxiv - Microbiology 2024Quote: ... MTase expression was then induced at 15°C according to the Cold Shock Expression System pColdTM DNA’s protocol (Takara Bio). 24 hours after the induction ...
-
bioRxiv - Molecular Biology 2024Quote: ... a double-stranded DNA fragment corresponding to the loxJT15+C290C+17:m7+FLAG+17:HT1+HA+17:HT2+MYC+17:N+V5 portion was synthesized (Integrated DNA Technologies) and inserted at the C-terminus of GFP within the pEGFP-C3 plasmid (Clontech) using a GenBuilder Cloning kit (GenScript) ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Microbiology 2020Quote: ... DNA fragments corresponding to MV-C or CH coding sequences were amplified using pTM3-MVSchw or pmCherry (Clontech, Palo Alto, USA) as a template ...
-
bioRxiv - Cell Biology 2020Quote: ... EGFP-Zdk1-NuMA-C was cloned into the CMV promoter plasmid mCherry-Zdk1-EB1-C (van Haren et al., 2018) as follows: mCherry was replaced by EGFP amplified from pEGFP-C1 (Clonetech, Takara Bio) and EB1-C was replaced by NuMA-C1701-2115 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lysates were centrifuged (1h, 4°C, 14000 xg) and the soluble fraction was passed through 1mL of Talon Metal Affinity Resin (Clontech #635509). The resin was washed for four times with 4mL Wash Buffer (50mM Tris pH7.5 ...
-
bioRxiv - Microbiology 2019Quote: ... (5’-GGT CTC TCT GGT TAG ACC AGA TCT GAG C-3’ and 5’-AAA CAT GGG TAT TAC TTC TGG GCT GAA AG-3’) using PrimeSTAR®HS (TAKARA) and purified by QIAquick Gel Extraction (QIAGEN) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mixtures were prewarmed at 37°C for 5 min and digested samples were treated with 66.6 U/mL (final conc.) MNase enzyme (Takara Bio, #2910A) at 37°C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... with a flag tag at the N terminal and an EGFP tag at the C terminal by the In-Fusion HD Cloning system (TaKaRa, 638909). After transfection of the U2OS cells with the pCMV-Tet3G Vector ...
-
bioRxiv - Immunology 2021Quote: ... Single stranded cDNA was synthesized immediately by adding 0.7 µl SMARTScribe reverse transcriptase (100 U/µl, f/c 2 U/µl, Takara Bio #639537), 7 µl First-Strand buffer (f/c 1×) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Full-length WDR5 was cloned in frame as N- or C-terminal NanoLuc-fusion pNLF1 vector using ligation independent in-fusion cloning (Takara Bio) and sequence verified ...
-
bioRxiv - Microbiology 2021Quote: ... RNAs were treated for 1 h by DNase I at 37°C and reverse-transcribed using a Prime ScriptTM RT reagent kit with gDNA Eraser (Takara, Japan). Quantitative PCR was performed as mentioned above ...
-
bioRxiv - Physiology 2021Quote: ... the pSTT91 and pGAD424 plasmids cloned with potential interactors were introduced into the Saccharomyces cerevisiae strain L40 and grown for 2 days at 30°C on a leucine- and tryptophan- deficient synthetic defined premixed yeast growth medium (SD-Leu-Trp, TaKaRa Clontech)(Hollenberg et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... Products were ligated to pCAMBIA1300 vector backbone containing the 35S promoter and a C-terminal YFP using the In-Fusion cloning system (Takara Bio).
-
bioRxiv - Neuroscience 2020Quote: ... The first strand of cDNA was synthesized by reverse transcription of the mRNA via a 1hr incubation at 42°C by adding the following to the reaction mixture above: 1µl SMARTScribe™ RT (Takara, #639538), 1µl dNTPs 10mM (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... HeLa cells stably expressing mKeima-P2A-FRB-Fis1 and FKBP-GFP-ATG13 and mutants were treated with A/C heterodimerizer (for simplicity, it is called “rapalog” in the figure) (Clontech#635056) for 24 h and then subjected to FACS analysis as previously described (Vargas et al. ...