Labshake search
Citations for Takara Bio :
651 - 700 of 803 citations for Recombinant Human SMPDL3A Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... protein solution was collected and subjected to purification using His60 Ni Superflow resin (TaKaRa, California, USA) to remove 6×His-SUMO tag from the protein preparations ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatants containing soluble target proteins were loaded into a Talon metal affinity resin (Clontech, USA). After washing three times with buffer A ...
-
bioRxiv - Molecular Biology 2023Quote: Protein interactions in vivo in yeast were assayed using the ‘Matchmaker Gold Two-hybrid System’ (Clontech) using the protocols provided by the supplier ...
-
bioRxiv - Molecular Biology 2022Quote: Cas9 and PFR2 protein was detected on western blots using the Guide-it Cas9 (Takara, 632607) and L8C4 (50 ...
-
bioRxiv - Biochemistry 2022Quote: ... Scaffolding protein was purified on a TALON Superflow metal affinity column (Takara Bio, San Jose, CA). Fractions containing scaffolding protein were pooled and concentrated in 12-14kDa MWCO dialysis tubing (Spectrum Chemical ...
-
bioRxiv - Synthetic Biology 2023Quote: ... protein-coding sequences for Tluc were replaced with corresponding fragments through In-Fusion cloning (Takara; 638948) or restriction cloning strategies ...
-
bioRxiv - Cell Biology 2023Quote: ... The fluorescent proteins were probed with anti-GFP monoclonal (JL8, 1:2,000 dilution; TaKaRa Bio Inc.) and anti-RFP polyclonal (PM005 ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Plant Biology 2019Quote: Each purified protein preparation of His-PHOT1 N2 and N4 was incubated with TALON Magnetic Beads (TaKaRa) at 4°C for 30 min and further incubated at 4°C for 30 min with in vitro transcription and translation reactant containing RPT2 N ...
-
bioRxiv - Plant Biology 2019Quote: ... 30 µg of microsomal proteins were then treated with 30 units of calf intestinal alkaline phosphatase (TaKaRa) at 37°C for 2 h ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Tissues expressing mCherry-tagged Yellow protein (ymCherry) were stained with rabbit anti-dsRed (Clontech 632496, 1:1000) and rat anti-DN-Cadherin (DN-Ex #8 ...
-
bioRxiv - Biochemistry 2019Quote: The supernatant from purification of His6-tagged proteins was loaded onto a self-packed cobalt column (Clontech). Unbound proteins were washed off with Loading Buffer (50 mM Tris-HCl [pH 7.4] ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Concentrated protein was bound to 0.5–1 mL of His60 nickel or HisTalon cobalt resin (Takara Bio) for 0.5–1 hr at 4°C while rotating in a 10-mL Pierce disposable column (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were expressed in Escherichia coli strain BL21(DE3) cells containing chaperone plasmid pG-KJE8 (TAKARA, 3340). When the optical density at 600 nm reached 0.6 ...
-
bioRxiv - Microbiology 2020Quote: ... the His-tagged spike protein produced in the culture supernatants was purified with a Talon resin (Clontech).
-
bioRxiv - Microbiology 2021Quote: U937 cell lines stably expressing red fluorescent protein membrane were generated using pDsRed-Monomer-Mem (Takara Bio) cloned into pLB vector from Addgene (Addgene plasmid 11619 ...
-
bioRxiv - Biochemistry 2019Quote: ... 500 µg protein at 1 mg/mL were prepared with Buffer A (Phosphoprotein Kit, Clontech, Cat#635626): 185 µL PC-3 lysate (pH 8.8) ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Plant Biology 2019Quote: ... Proteins were transferred onto a PVDF membrane and blotted using 1:2000 a-GFP (Cat 632381, Clontech), 1:2000 a-actin (AS13 2640 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP.
-
bioRxiv - Developmental Biology 2020Quote: ... Both chicken DLX1 and DLX1 Q50E proteins were purified using Capturem His-Tagged Purification Maxiprep Kit (Clontech), and verified by Western blot with primary antibodies against 6x His tag (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... The concentration of the purified protein was assessed by densitometry using bovine serum albumin (TaKaRa, cat. # T9310A) as a standard following SDS-PAGE and staining with the Q-stain ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNAs encoding for sequences of proteins of interest were amplified and inserted into pEGFP-N1 vector (Clontech). Each DNA construct was checked by conventional Sanger sequencing of purified plasmid.
-
bioRxiv - Bioengineering 2024Quote: ... All proteins were purified with a Talon metal affinity resin (Takara Bio USA, Mountain View, CA, USA) and dialyzed against pyrogen-free PBS ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The Northern dot blots containing cDNAs from primary human tumors (T) with paired adjacent normal tissues (N) and cancer cell lines were obtained from Clontech (Cancer Profiling Array, #7840-1). The blots contained normalized cDNA isolated from tumors and the corresponding adjacent normal tissues from individual cancer patients ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
bioRxiv - Plant Biology 2021Quote: ... All Rec and Rad proteins were translationally fused with the Activation Domain (AD) of pGADT7 AD (Takara Bio). βC1 was fused with Binding Domain (BD ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP-TSN-interacting proteins and native TSN were detected by mouse α -GFP (monoclonal antibody JL-8; Clontech) and rabbit α-TSN antibodies at final dilutions of 1:1,000 and 1:5,000 ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA isolation and reverse transcription were performed as described in the STAR METHODS section “Ddi2 expression analysis in mouse embryos using qRT-PCR.” Constructs encoding the DDI2WT and DDI2PD proteins were cloned into p905 (gift from Pavlína Řezáčová, IOCB CAS, Prague) and pTreTight (Clontech) expression vectors.
-
bioRxiv - Developmental Biology 2022Quote: ... The expression of Dunk protein was confirmed by Western blot using c-Myc Monoclonal Antibody (Takara, Cat# 631206). Then ...
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Plant Biology 2022Quote: ... bait and linker proteins were cloned into the appropriate position of the pBridge vector (Clontech, Mountain View, California), which encodes a GAL4 DNA binding domain and a linker protein ...
-
bioRxiv - Cell Biology 2023Quote: ... Cre recombinase proteins were delivered into TP53-missense mutation knock-in cells using Cre Recombinase Gesicles (Takara Bio).