Labshake search
Citations for Takara Bio :
651 - 700 of 936 citations for Rabbit Anti Human IgG+IgM+IgA FITC since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and 1.25Lμg pVSV-G (second-generation lentivirus packaging system) into human embryonic kidney packaging cells GP2-293 (Clontech, Inc., Mountain View, CA, USA), using CalPhos™ Mammalian Transfection Kit (Clontech ...
-
bioRxiv - Cell Biology 2024Quote: ... A bicistronic construct expressing human EPAC1b with a C-terminal His10 tag and SUMO3(Q89K) was constructed using the pIRES2-EGFP vector (Clontech Catalog no. 632435). The EPAC1-His10-IRES-SUMO3(Q89K ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibodies and dyes were used at following dilutions: rabbit-α-dsRed (1:500, Takara, #632496; RRID:AB_10013483), α-HRP conjugated with Alexa Fluor-488 (1:250 ...
-
bioRxiv - Neuroscience 2023Quote: ... a mix of an mCherry-DsRed rabbit polyclonal antibody (Living Colors-Clontech Antibody 632496, 1:1000) and a mouse monoclonal antibody against oxytocin (P38 ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse JL8 anti-GFP (Clontech, 632381); mouse P124 anti-desmoglein 1 (Progen ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Clontech, 1:5000) rat anti-RFP (Chromotek ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-mCherry (632543, Takara, 1:1,000), anti-SUMO2/3 (ab3742 ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-DsRed (1/500, 632496, Clontech), anti-cleaved caspase-3 (1/500 ...
-
Programmed ER fragmentation drives selective ER inheritance and degradation in budding yeast meiosisbioRxiv - Cell Biology 2021Quote: ... anti-GFP JL8 (Clontech, 1:2000), anti-V5 (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... rat anti-E-Cadherin (TAKARA; M110), rat anti-Endomucin (Santa Cruz ...
-
bioRxiv - Molecular Biology 2022Quote: ... an anti-mCherry antibody (#Z2496N, TaKaRa), or a horseradish peroxidase-conjugated anti-α-tubulin antibody (#HRP-66031 ...
-
bioRxiv - Pathology 2022Quote: ... Rat anti Mouse OCN (Takara, M188); Rabbit anti Mouse MGST1 (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP monoclonal JL8 (Clontech), mouse anti-myc (Cell Signaling Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-dsRed (Clontech #632496, 1:300), anti-c-Myc (Santa Cruz #SC40 ...
-
bioRxiv - Plant Biology 2022Quote: ... The anti-GFP antibody (TaKaRa, 632381), the anti-LhcB2 antibody (Agrisera ...
-
bioRxiv - Plant Biology 2022Quote: ... and anti-GFP (632381; Clontech, USA) antibodies ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti GFP antibody (Clontech, lot. 1404005) and anti-H3 (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... We used mouse anti-GFP (Takara) at 1:1000 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-Ocn (Takara, M173; 1:800), anti-CD31 (BD ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (Clontech,1:6,000), mouse anti-FLAG (Millipore-Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The Northern dot blots containing cDNAs from primary human tumors (T) with paired adjacent normal tissues (N) and cancer cell lines were obtained from Clontech (Cancer Profiling Array, #7840-1). The blots contained normalized cDNA isolated from tumors and the corresponding adjacent normal tissues from individual cancer patients ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were anti-PLP (N-terminus; 1:5000, Rogers, 2008) anti-GFP (JL8; 1:2000 – 5000; Clontech); anti-alpha-Tubulin (DM1A ...
-
bioRxiv - Biophysics 2021Quote: ... and anti-mCherry (#Z2496N, TaKaRa, Shiga, Japan).
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-mCherry 1:500 (632543, Clontech); chicken anti-Gfp 1:500 (ab13970 ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-GFP (1:1000; Clontech #632460), rabbit anti-somatostatin (1:500 ...
-
Dual functionality of the TasA amyloid protein in Bacillus physiology and fitness on the phylloplanebioRxiv - Microbiology 2019Quote: ... a commercial anti-GFP primary antibody (Clontech living colors full-length polyclonal antibody ...
-
bioRxiv - Physiology 2019Quote: ... Guinea pig anti-glucagon (Takara, 1:2000), Rabbit anti-MafB (Bethyl ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-GFP clone JL-8 (Takara 632381) 0.5 µg/mL ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-GFP (Clontech 632381 1:2000). Membrane was then washed three times in 1x TBST and incubated with goat-anti-rabbit (Jackson ImmunoResearch 111-035-046 1:5000 ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-GFP (Clontech 632381 1:2000). The membrane was then washed three times in TBST and incubated with goat-anti-rabbit (Jackson ImmunoResearch 111-035-046 1:5000 ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... Anti-Cas9 antibody (Takara, 632607; 1:1000) and anti-GFP antibody (Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies anti-HA.11 (Clontech, 631207) or anti-A3H were used at a dilution at 1:500 and 1:50 ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-GFP 1:1000 (Clontech, 632380), anti-α-syn 1:1000 (C-20 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-dsRed (632496, Clontech; 1:300).
-
bioRxiv - Microbiology 2021Quote: ... mouse anti GFP (#632381, Takara Bio Clontech), mouse anti Vinculin (#V9131-100UL ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti GFP (#632381, Takara Bio Clontech), mouse anti Vinculin (#V9131-100UL ...
-
bioRxiv - Cell Biology 2020Quote: ... anti dsRed at 1:500 (Takara #632496), anti Polyubiquitin (“PolyUb” ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse-anti-mCherry (Clontech, 632543 1:1000). Secondary antibodies ...
-
bioRxiv - Molecular Biology 2022Quote: ... Anti-6xHis (631212, 1:10,000) from Clontech. Anti-Ubiquitin (646302 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-H3K27me1 (1:1000, Takara, #MABI0321-100I), anti-H3K27ac (1:4000 ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-dsRED 1:1000 (Clontech, Cat.no. 632496), anti-Tbr1 1:1000 (Abcam ...
-
bioRxiv - Biochemistry 2019Quote: ... anti-GFP-tag (Living Colors 632592; Clontech), anti-Strep-tag (34850 ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-GFP (1:200; Clontech #632381) overnight at 4⁰C ...