Labshake search
Citations for Takara Bio :
651 - 700 of 1193 citations for Mouse Anti Chikungunya Virus E2 Protein 16A12 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... All proteins were purified with a Talon metal affinity resin (Takara Bio USA, Mountain View, CA, USA) and dialyzed against pyrogen-free PBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... primary antibodies (chicken anti-GFP, Abcam, ab13970, 1:2000 and rabbit anti-DsRed, Clontech, 632496, 1:200) were incubated overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... Bulk TCR sequencing was performed using the SMARTer® Mouse TCR a/b Profiling Kit (Takara Bio). Libraries were sequenced using the 600-cycle MiSeq Reagent Kit v3 (Illumina ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse ESCs were seeded on a gelatin coated dish and cultured in the NDiff 227 medium (TAKARA) for 5 days33 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The GFP-mCDCA7 construct was generated by cloning mouse Cdca7 cDNA into the pEGFP-C1 vector (Clontech). The GST-mCDCA7 CRD (pXC2025 ...
-
bioRxiv - Microbiology 2023Quote: ... Standard immunoblotting procedures were performed using a primary antibody against GFP (mouse monoclonal JL-8 antibody, Takara) and a secondary antibody goat anti-mouse IgG-peroxidase antibody (Sigma) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were anti-PLP (N-terminus; 1:5000, Rogers, 2008) anti-GFP (JL8; 1:2000 – 5000; Clontech); anti-alpha-Tubulin (DM1A ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were incubated with chicken anti-GFP 1:1000 (Aves) and rabbit anti-DsRed 1:500 (Clontech/Takara) antibodies diluted in blocking solution overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were incubated with chicken anti-GFP 1:1000 (Aves) and rabbit anti-DsRed 1:500 (Clontech/Takara) antibodies diluted in blocking solution overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
bioRxiv - Plant Biology 2021Quote: ... All Rec and Rad proteins were translationally fused with the Activation Domain (AD) of pGADT7 AD (Takara Bio). βC1 was fused with Binding Domain (BD ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA isolation and reverse transcription were performed as described in the STAR METHODS section “Ddi2 expression analysis in mouse embryos using qRT-PCR.” Constructs encoding the DDI2WT and DDI2PD proteins were cloned into p905 (gift from Pavlína Řezáčová, IOCB CAS, Prague) and pTreTight (Clontech) expression vectors.
-
bioRxiv - Developmental Biology 2022Quote: ... The expression of Dunk protein was confirmed by Western blot using c-Myc Monoclonal Antibody (Takara, Cat# 631206). Then ...
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Plant Biology 2022Quote: ... bait and linker proteins were cloned into the appropriate position of the pBridge vector (Clontech, Mountain View, California), which encodes a GAL4 DNA binding domain and a linker protein ...
-
bioRxiv - Cell Biology 2023Quote: ... Cre recombinase proteins were delivered into TP53-missense mutation knock-in cells using Cre Recombinase Gesicles (Takara Bio).
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged CRONE protein was purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified MBP-mEGFP/mCherry-Seb1 and MBP-mEGFP/mCherry-Rhn1 proteins were incubated with HRV 3C protease (Takara; 1 U/1 g of target recombinant proteins ...
-
bioRxiv - Microbiology 2024Quote: ... and the protein was purified using cobalt affinity resin (1mL/L culture, Takara Bio USA, San Jose, CA). The protein was washed with 100 mM NaCl ...
-
bioRxiv - Biophysics 2021Quote: ... and anti-mCherry (#Z2496N, TaKaRa, Shiga, Japan).
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti- dsRed (1:500; Takara Bio), guinea pig anti-Loaf (1:400 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-DsRed 1:1000 (Clontech, #632496), mouse anti-Arm 1:3 (Hybridoma Bank ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-DsRed (Clontech, 632496, 1:200), mouse anti-Tubulin (Sigma T5168 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (1:500, Clontech #632496), goat anti-rat 647 (1:400 ...
-
Dual functionality of the TasA amyloid protein in Bacillus physiology and fitness on the phylloplanebioRxiv - Microbiology 2019Quote: ... a commercial anti-GFP primary antibody (Clontech living colors full-length polyclonal antibody ...
-
bioRxiv - Physiology 2019Quote: ... Guinea pig anti-glucagon (Takara, 1:2000), Rabbit anti-MafB (Bethyl ...
-
bioRxiv - Neuroscience 2019Quote: ... Rabbit anti-DsRed (Clontech, Mountain View, CA) and chicken anti-GFP (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... 1:400 rabbit anti-DsRed (632496, Clontech), 1:800 mouse anti-mGluR1a (556389 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-GFP clone JL-8 (Takara 632381) 0.5 µg/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-DsRed (1:1000, 632496, Clontech); rabbit anti-HA (1:300 ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-GFP (Clontech 632381 1:2000). Membrane was then washed three times in 1x TBST and incubated with goat-anti-rabbit (Jackson ImmunoResearch 111-035-046 1:5000 ...
-
bioRxiv - Biochemistry 2021Quote: ... and anti-GFP (Clontech 632381 1:2000). The membrane was then washed three times in TBST and incubated with goat-anti-rabbit (Jackson ImmunoResearch 111-035-046 1:5000 ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (1/500, Clontech, 632496). Sections were then incubated for 2 h at room temperature with appropriate fluorescent secondary antibodies diluted in PBS – 1% normal serum ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-DsRed (1:1000) (632496, Clontech), goat anti-CGRP (1:500 ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... Anti-Cas9 antibody (Takara, 632607; 1:1000) and anti-GFP antibody (Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies anti-HA.11 (Clontech, 631207) or anti-A3H were used at a dilution at 1:500 and 1:50 ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-GFP 1:1000 (Clontech, 632380), anti-α-syn 1:1000 (C-20 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-dsRed (632496, Clontech; 1:300).
-
bioRxiv - Cell Biology 2020Quote: ... anti dsRed at 1:500 (Takara #632496), anti Polyubiquitin (“PolyUb” ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal anti-DsRed (1:500; ClonTech). The secondary antibodies Cy3 ...