Labshake search
Citations for Takara Bio :
651 - 700 of 762 citations for Irisin Human Mouse Rat HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Signals for eGFP and FLAG were detected by using Mouse Anti-GFP JL-8 (Clontech), Mouse Anti-Flag (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... and TRIM27 cDNA was obtained in pENTR221 vectors from the UT Southwestern (UTSW) McDermott Center for Human Genetics and subcloned into pCMV-HA or pCMV-myc (Clontech, Mountain View, CA) between SalI and NotI restriction sites ...
-
bioRxiv - Systems Biology 2019Quote: ... PCR amplification allowed to obtain the coding sequence for human HSF1 that was cloned into peGFP N3 vector (Clontech Laboratories Mountain View, CA); the plasmid was then verified by sequencing (GATC Biotech ...
-
bioRxiv - Immunology 2022Quote: ... Viruses were packaged in human embryonic kidney (HEK) 293 cells and viral supernatants were processed using Retro-X concentrators (Takara Bio. USA Inc). Naïve CD8 T cells were purified by negative-selection and stimulated in vitro with plate-bound anti- CD3/CD28 ...
-
bioRxiv - Neuroscience 2021Quote: ... under control of the modified human GFAP promoter, GfaABC1D (Lee et al., 2008) using restriction cloning and In-Fusion HD assembly (Clontech, Takara Bio, USA). The following sequence elements were obtained from Addgene ...
-
bioRxiv - Biochemistry 2021Quote: A cDNA fragment encoding full-length human EGFR (UniProt accession no. P00533) was cloned into the pEGFP-N1 plasmid (Clontech, Mountain View, CA). To facilitate affinity purification ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1.25Lμg pVSV-G (second-generation lentivirus packaging system) into human embryonic kidney packaging cells GP2-293 (Clontech, Inc., Mountain View, CA, USA), using CalPhos™ Mammalian Transfection Kit (Clontech ...
-
bioRxiv - Neuroscience 2022Quote: Human embryonic stem cell (hESC)-derived cerebral organoids (hCOs) were generated from a commercially available hESC stem cell line (Takara Bio, Osaka, Japan), using the STEMdiff cerebral organoid kit (STEMCELL Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... A bicistronic construct expressing human EPAC1b with a C-terminal His10 tag and SUMO3(Q89K) was constructed using the pIRES2-EGFP vector (Clontech Catalog no. 632435). The EPAC1-His10-IRES-SUMO3(Q89K ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TCR beta chain libraries were generated using SMARTer Mouse TCR a/b Profiling Kit (Clontech). Samples were pooled to a final pool concentration of 4 nM and diluted to a final concentration of 13.5 pM ...
-
bioRxiv - Plant Biology 2019Quote: Primary antibodies were monoclonal antibodies from mouse: α-GFP (JL-8, 1:5000, Takara, Shiga, Japan) or rat ...
-
bioRxiv - Biophysics 2021Quote: Full length mouse ILK cDNA was cloned into the EcoRI site of pEGFP-N1 plasmid (Clontech). The R255A ...
-
bioRxiv - Microbiology 2022Quote: ... Input and elution samples were analyzed by immunoblot using mouse anti-GFP (1:5,000, Clontech #632381) to detect A3-EGFP ...
-
bioRxiv - Developmental Biology 2022Quote: Primary antibodies and concentrations used: mouse anti-GFP Living Colors (JL-8) (Takara Biosciences; cat# 632381) 1:500 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Immunoblotting was performed using an anti-GFP mouse monoclonal antibody (JL8; 1:1000; TaKaRa Bio Inc.) and an anti-ubiquitin mouse monoclonal antibody (P4D1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were stained with anti-mouse E-cadherin monoclonal antibody ECCD-2 (1:100, Takara) for 16 h at 4°C ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The Northern dot blots containing cDNAs from primary human tumors (T) with paired adjacent normal tissues (N) and cancer cell lines were obtained from Clontech (Cancer Profiling Array, #7840-1). The blots contained normalized cDNA isolated from tumors and the corresponding adjacent normal tissues from individual cancer patients ...
-
bioRxiv - Cell Biology 2019Quote: ... The blots were incubated overnight at 4°C with a mouse anti-GFP antibody (RRID:AB_2323808, 63281, Clontech) at a 1:2,000 dilution in blocking buffer ...
-
bioRxiv - Immunology 2022Quote: ... Bulk TCR sequencing was performed using the SMARTer® Mouse TCR a/b Profiling Kit (Takara Bio). Libraries were sequenced using the 600-cycle MiSeq Reagent Kit v3 (Illumina ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse ESCs were seeded on a gelatin coated dish and cultured in the NDiff 227 medium (TAKARA) for 5 days33 ...
-
bioRxiv - Cell Biology 2020Quote: Antibodies used in this study were as follows: mouse anti-GFP (JL-8, dilution 1:1000) (Clontech); Alexa 488- ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated in primary antibody (1:1,000 mouse anti-calbindin, Sigma; 1:500 rabbit anti-DsRed, Clontech; 1:1,000 guinea pig anti-vGluT1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The following primary antibodies were used: mouse anti-Nc82 (Laissue et al., 1999) rabbit anti-DsRed (TaKaRa Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... The GFP-mCDCA7 construct was generated by cloning mouse Cdca7 cDNA into the pEGFP-C1 vector (Clontech). The GST-mCDCA7 CRD (pXC2025 ...
-
bioRxiv - Cell Biology 2023Quote: ... The following antibodies were used for the study: mouse anti-GFP (632381, JL-8, Clontech, 1:1000), rabbit anti-mCherry (GTX128508 ...
-
bioRxiv - Microbiology 2023Quote: ... Standard immunoblotting procedures were performed using a primary antibody against GFP (mouse monoclonal JL-8 antibody, Takara) and a secondary antibody goat anti-mouse IgG-peroxidase antibody (Sigma) ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP-TSN-interacting proteins and native TSN were detected by mouse α -GFP (monoclonal antibody JL-8; Clontech) and rabbit α-TSN antibodies at final dilutions of 1:1,000 and 1:5,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... a mouse monoclonal antibody for bovine osteocalcin (code no. M042, clone no. OCG2; Takara Bio Inc., Shiga, Japan), and goat polyclonal antibody for FBXW2 (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated with primary antibody (anti-Th [mouse] 1:1500, Immunostar; anti-dsRed [rabbit] 1:1500, Clontech) overnight at RT shaking ...
-
bioRxiv - Immunology 2022Quote: ... IGK and IGL 5’RACE AIRR-seq libraries were generated using the SMARTer Mouse BCR Profiling Kit (Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... which was used to screen a Mate & Plate™ Library-Universal Mouse (Normalized) (Clontech, Mountainview, CA; Cat#: 630482) using the stringent protocol according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were diluted in 5% milk in PBS-T + 0.01% sodium azide (1:2,000 for mouse anti-GFP (Clontech) and mouse anti-3V5 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: RNA extracion from the cells and mouse hearts was performed using the sophisticated Trizol reagent (Takara, Kyoto, Japan). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: pEGFP-USP48 was generated by sub-cloning the mouse USP48 into the mammalian expression vector pEGFP-C2 (Clontech). pCMV-Myc-USP48 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retroviral transduction was achieved by spinoculation of 3 × 106 mouse T cells on retronectin-coated plates (Takara Bio) with neat retroviral supernatant harvested from 293T packaging cells (2000xg ...
-
bioRxiv - Bioengineering 2024Quote: ... GFP was detected with a monoclonal mouse anti-GFP antibody (JL-8, Takara Bio USA, San Jose, CA) in Western blot analyses.
-
bioRxiv - Molecular Biology 2020Quote: ... ∼900 bp homology arms to Usp9x were amplified from mouse genomic DNA using PrimeStar GXL polymerase (Takara, CA, USA) and Gibson assembly primers with 21 nucleotide overlap to adjacent fragments ...
-
bioRxiv - Plant Biology 2019Quote: ... proteins were transferred to PVDF membrane and blotted proteins were incubated in a 1:10,000 dilution of mouse monoclonal anti-GFP antibody (Living Colors JL-8, Clontech) followed by 1:5000 horseradish peroxidase conjugated sheep anti-mouse IgG antibody (Amersham ...
-
bioRxiv - Cell Biology 2022Quote: ... 5um sections from paraffin blocks were used for immunofluorescence staining with the following primary antibodies: tdTomato (dsRed Mouse: Takara Biosystems 632392 ...
-
bioRxiv - Neuroscience 2021Quote: ... Three technical replicates of 300 cells each were sorted from each individual mouse into 1.5mL microcentrifuge tubes containing cell lysis buffer buffer from the Clontech SMART-Seq HT (Takara) kit for direct cDNA synthesis and RNAseq library generation.
-
bioRxiv - Cell Biology 2019Quote: ... 10 µg of the lysates were separated by SDS-PAGE and blots were probed with a 1:2,000 dilution of mouse anti-GFP antibody (Clontech), followed by 1:5000 anti-mouse Starbright Blue 700 (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... NPR1-GFP proteins were detected by reacting the blots with the mouse monoclonal anti-GFP monoclonal antibody (Clontech, USA) and horseradish peroxidase-conjugated secondary antibody (Santa Cruz ...