Labshake search
Citations for Takara Bio :
651 - 700 of 1390 citations for Ethyl 5 3R 3 4 dihydroxybutyl thiophene 2 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and the 3’ flanking region) and the linearized pHIS906 were fused using the In-Fusion enzyme (TAKARA, Shiga, Japan) to create the pHIS3-AWP1 plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... filtered through a 0.45 µm polyethersulfone filter and used directly or concentrated 3-fold with Lenti-X Concentrator (Clontech).
-
bioRxiv - Biophysics 2024Quote: ... to reduce the detergent concentration and incubated for 3 h with 10 mL Talon metal affinity resin (Takara Biotech) pre-equilibrated with buffer S supplemented with 0.1% β-DDM and 0.02% CHS ...
-
bioRxiv - Immunology 2024Quote: ... sfGFP-3×P3-DsRed and homology arms were PCR-amplified using PrimeSTAR® Max DNA Polymerase (Takara Bio, R045). Primers for PCR were designed using the NEBuilder Assembly Tool ...
-
bioRxiv - Developmental Biology 2024Quote: ... The HRT for attaching GFP at the 3’ end of pan-1 was made by PCR (Takara PrimeStar Max) from plasmid pPD95.75 (Addene #1494 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Its male-specific exon was amplified using Advantage® 2 Polymerase Mix (TaKaRa), the gene-specific primer “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of cDNA was amplified using Advantage HF 2 DNA polymerase (Takara) for 25-30 cycles according to the manufacturer’s instructions (Fw 5’-GGGATTAAAGGTTTATACCTTCCC-3’ and Rv 5’-TCGTTGAAACCAGGGACAAG-3’) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA molecules were amplified using the Advantage 2 PCR kit (639206, Takara Bio) with initial denaturation at 95 °C for 1 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and gene-specific primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized by adding 2 μl of PrimeScriptTM RT reagent kit (TaKaRa) to 500μg of RNA samples in 8 μl of distilled water (DW ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and primers specific for each gene ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative real-time PCR was carried out using 2× TB-Green premix (TaKaRa) on a LightCycler-480®II (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and either 2 μg of the Tet-On-3G transactivator (pLVX Tet3G, Clontech) or 2 μg of the pLenti-CMVtight-Hygro-DEST plasmid with each cDNA of interest ...
-
bioRxiv - Biochemistry 2023Quote: ... the supernatant was incubated for 2 hr with TALON metal affinity resin (Takara) pre-equilibrated with 50 mM Tris-HCl [pH 7.6] ...
-
bioRxiv - Genomics 2024Quote: ... 0.8 mM dNTP mix and 2 U Ex Taq polymerase (TaKaRa, Otsu, Japan). The thermal profile of the reaction started with initial stage 90 s at 94 °C which was followed by 30 cycles of 45 s denaturation at 94 °C ...
-
bioRxiv - Genomics 2024Quote: ... 1x Ex Taq buffer and 2 U Ex Taq polymerase (TaKaRa, Otsu, Japan). The thermal profile started with initial stage 94 °C for 3 min which was followed by 30 cycles of 1 min denaturation at 94 °C ...
-
bioRxiv - Genetics 2024Quote: ... and PCR was carried out using 2×Ex Taq Master Mix (TaKaRa CW0718). The PCR reaction was composed of 0.5 µg of template ...
-
bioRxiv - Developmental Biology 2024Quote: ... rat monoclonal anti-E-cadherin antibody (ECCD-2) (1:200) (Takara, Cat# M108), mouse monoclonal anti-Yap1 antibody (MO1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The cDNA library was prepared using an Advantage 2 PCR Kit (Clontech, 639206) and then sequenced via the Illumina sequencing platform (NovaSeq 6000) ...
-
bioRxiv - Genomics 2020Quote: ... 5 × 104 cells were stored at −80 °C in STEM CELLBANKER® (Takara Bio Inc.) until use ...
-
bioRxiv - Plant Biology 2020Quote: The 5’ Digoxigenin labeled R-box and non-labeled oligonucleotides were synthesized (Takara, Dalian, China). The binding mixture contained nuclear extracts ...
-
bioRxiv - Biophysics 2022Quote: ... This was then loaded onto a column with 5 ml His60 Ni-Superflow Resin (Clontech) previously equilibrated in the lysis buffer ...
-
bioRxiv - Microbiology 2021Quote: ... RNAs were probed with γ32P 5’ end-labeled oligonucleotide (Table S3) in ExpressHyb solution (Clontech) and scanned after exposition with Typhoon FLA 9500 scanner (GE Healthcare).
-
bioRxiv - Molecular Biology 2020Quote: ... They were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Oligo Clean & Concentrator (Zymo Research ...
-
bioRxiv - Immunology 2024Quote: ... QPCR was then performed with a reaction mixture consisting of 5 μL SYBR Green (Takara), 0.2 μL Rox ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Cla I sites 5′ to the BamH I site (Clontech, Mountain View, CA, USA).
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... and CCR6high and transduced with lentivirus particles at an MOI of 5 using retronectin (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and the 5′-end was phosphorylated with T4 polynucleotide kinase (Cat. # 2021S: Takara, Kyoto, Japan). This phosphorylated DNA fragment was ligated to the Bbs I cloning site in pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Microbiology 2023Quote: ... Synthesized DNA was cloned into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was prelinearized with NotI-HF (New England Biolabs [NEB] ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4°C with rabbit anti-DsRed (1:500 in BB; Clontech 101004), mouse anti-Myh6 antibody (1:200 in BB ...
-
bioRxiv - Immunology 2020Quote: ... Activated NK cells were transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 ng of firefly luciferase (pGL) by using 4 µl of TransIT 293 (Takara, Shiga, Japan) and 140 µl of OPTI- MEM (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The extract was incubated for 1 h at 4 °C with Talon resin (Clontech, Mountain View, CA), loaded onto a column ...
-
bioRxiv - Immunology 2023Quote: ... RNA was then amplified using SMART-Seq v.4 Ultra Low Input RNA kit (Clontech, cat. 63488). Subsequently ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... Specific forward and reverse primers (Suppl Table 3) were designed using the In-Fusion Cloning Primer Design Tool from TaKaRa (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting plasmids were co-transformed into Saccharomyces cerevisiae strain AH109 according to the protocols in the Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The yeast cells were cultured on SD/-Leu-Trp (-LW ...
-
bioRxiv - Molecular Biology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [18] (ii ...
-
bioRxiv - Microbiology 2021Quote: ... CPER fragments containing WT or mutated or 3’UTRs were amplified from the plasmids using PrimeStar GXL polymerase (Takara, Japan) and gel-purified ...
-
bioRxiv - Microbiology 2021Quote: Evaluation of protein interactions by the GAL4-based Y2H system was performed by following the manufacturer’s recommendations for the Matchmaker GAL4 Two-hybrid System 3 (Clontech, USA). Competent AH109 yeast cells (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [3] ...
-
bioRxiv - Microbiology 2020Quote: ... was co-transformed with different bait-prey combinations as indicated in Extended Data Fig.1 in accordance with instructions for Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The transformed yeast was then screened in 4-dropout plates for the protein-protein interaction.
-
bioRxiv - Biophysics 2020Quote: Target DNA containing the 5′-TTTA-3′ PAM was ordered from IDT and cloned into a pET28-MHL vector using the In-Fusion Cloning Kit (ClonTech). Plasmids were linearized before usage ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCRs (sqPCRs) were performed on 3 μl of cDNA template using Emerald Amp Max PCR Master Mix (Takara). The sequences of the primers used for PCR amplifications are included in Supplemental Table 4.
-
bioRxiv - Neuroscience 2020Quote: ... cerevisiae strains used for yeast two-hybrid analysis were Y187 (MATα, ura3-52, his3-200, ade2-101, trp1-901, leu2-3, 112, gal4Δ, met–, gal80Δ, URA3::GAL1UAS-GAL1TATA-lacZ; Clontech) and Y2H Gold (MATa ...
-
bioRxiv - Genomics 2021Quote: ... These nanowells were selected for subsequent targeted deposition of 50□nl/nanowell RT-PCR reaction mix from the SMARTer ICELL8 3’ DE Reagent Kit (Takara) using the MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-GGC ATG GAC GAG CTG TAC AAG TCC AAT TTA CTG ACC GTA CAC-3’ and on pEGFP-C1 (Clontech) with primer ...
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Takara).