Labshake search
Citations for Takara Bio :
651 - 700 of 731 citations for BD 3 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: Jacob-LMO4 interaction was reconfirmed using fusion vectors (bait vector pGBKT7, prey vector pGADT7) using MATCHMAKER Two-Hybrid System 3 (Takara Bio Europe/Clontech, France). Co-transformed yeasts were assayed for growth on quadruple drop-out medium (SD/–Ade/–His/–Leu/–Trp ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reactions at every examined depth were performed in triplicate (n=3) using Takara SpeedSTAR HS DNA polymerase kit (Takara Bio USA, Madison, WI) with the following modifications ...
-
bioRxiv - Cell Biology 2024Quote: ... Ten nanograms of RNA were used for preparing indexed libraries using SMARTer Stranded Total RNA-Seq Pico-Input Mammalian kit v.3 (Takara Bio. Cat# SKU: 634487) as per manufacturer’s instructions (except that fragmentation was performed for 3 minutes of fragmentation at 94 °C and 13 cycles was used for PCR2) ...
-
bioRxiv - Plant Biology 2020Quote: ... while specific AD and BD recombinant plasmid pairs were used to co-transform yeast strain AH109 cells according to the Yeast Protocols Handbook (Takara, Dalian, China).
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression level of Venus and Venus-tagged arrestin-3 proteins was determined with anti-GFP JL-8 antibody (#632381, Takara Bio USA, San Jose, CA). The endogenous β-actin (loading control ...
-
bioRxiv - Molecular Biology 2020Quote: ... ∼900 bp homology arms to Usp9x were amplified from mouse genomic DNA using PrimeStar GXL polymerase (Takara, CA, USA) and Gibson assembly primers with 21 nucleotide overlap to adjacent fragments ...
-
bioRxiv - Plant Biology 2019Quote: ... proteins were transferred to PVDF membrane and blotted proteins were incubated in a 1:10,000 dilution of mouse monoclonal anti-GFP antibody (Living Colors JL-8, Clontech) followed by 1:5000 horseradish peroxidase conjugated sheep anti-mouse IgG antibody (Amersham ...
-
bioRxiv - Cell Biology 2022Quote: ... 5um sections from paraffin blocks were used for immunofluorescence staining with the following primary antibodies: tdTomato (dsRed Mouse: Takara Biosystems 632392 ...
-
bioRxiv - Neuroscience 2021Quote: ... Three technical replicates of 300 cells each were sorted from each individual mouse into 1.5mL microcentrifuge tubes containing cell lysis buffer buffer from the Clontech SMART-Seq HT (Takara) kit for direct cDNA synthesis and RNAseq library generation.
-
bioRxiv - Cell Biology 2019Quote: ... 10 µg of the lysates were separated by SDS-PAGE and blots were probed with a 1:2,000 dilution of mouse anti-GFP antibody (Clontech), followed by 1:5000 anti-mouse Starbright Blue 700 (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... NPR1-GFP proteins were detected by reacting the blots with the mouse monoclonal anti-GFP monoclonal antibody (Clontech, USA) and horseradish peroxidase-conjugated secondary antibody (Santa Cruz ...
-
bioRxiv - Microbiology 2022Quote: ... A 5 µl aliquot was removed from each sample for immunoblots using mouse anti-GFP (1:5,000, Clontech #632381) to detect A3-EGFP ...
-
bioRxiv - Pathology 2022Quote: ... mouse brains were extracted after cardiac perfusion with cold phosphate buffered saline (PBS) and homogenized by RNAiso Plus (TAKARA) and homemade RIPA buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-nc82 (1:50; Developmental Studies Hybridoma Bank) and rabbit anti-RFP (1:1000; TaKaRa Bio USA, #632496) at room temperature with agitation for 2 days ...
-
bioRxiv - Microbiology 2023Quote: ... and subsequently stained using a horseradish peroxidase (HRP)-conjugated monoclonal anti-StrepTag antibody (Iba) or mouse anti-6His (Clontech) monoclonal antibody combined with rabbit anti-mouse-HRP polyclonal antibodies (DAKO) ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse MEFs (RIKEN BioResource Center, Tsukuba, Japan), mouse RAW264.7 macrophages (RIKEN BioResource Center, Tsukuba, Japan) and Lenti-X 293T (Clontech) were cultured at 37°C in 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed Rapid-Amplification-of-cDNA-Ends (RACE) PCR using transcript-specific primers and the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: msPLCε cDNA was amplified by PCR from a mouse liver first-strand cDNA library (kindly gifted from Tomohiro Ishii) using Tks Gflex polymerase (TaKaRa) and was cloned between the NheI and KpnI sites of pECFP-N1 (Clontech ...
-
bioRxiv - Systems Biology 2022Quote: ... The blocked membrane was incubated overnight at 4 ℃ in primary antibodies: mouse polyclonal anti-Cas9 (Takara Bio, cat. no. 632607), mouse monoclonal anti-β-actin (8H10D10 ...
-
bioRxiv - Cell Biology 2019Quote: Expression plasmid for mouse FLAG tagged BAG3 (pFLAG-BAG3) was constructed by cloning partial mouse BAG3 cDNA containing the whole CDS into pEGFP-N1 (Clontech). Forward primer sequence used to clone BAG3 plasmid is 5′-AAAGGATCCAGCGCCGCCACCC-3′ and the reverse primer sequence is 5′-GACTCTAGATCACTAGGGAGCCACCAGGTTGC-3′ ...
-
bioRxiv - Genetics 2019Quote: ... liver and kidney), mouse tissues (brain, liver, heart, testis and kidney) and rat tissues (brain, liver and kidney) were purchased from Takara Bio Inc.
-
bioRxiv - Microbiology 2021Quote: ... 5′-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... 5’ s-RACE cDNA was obtained from bulk-sorted B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNAs encoding full-length human HCN1 channel and mouse TRIP8b (splicing variant 1a-4) were cloned into the pcDNA 3.1 (Clontech Laboratories) mammalian expression vector ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were then co-transfected with 150 ng of the pBiFC-HA-Casp2(S384E)-VC155 and pBiFC-HA-Casp2(S384E)-VN173 (mouse caspase-2) for BiFC and 10 ng of pDsRed-Mito (Clontech) as a transfection reporter plasmid ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA from mouse cochleae was extracted using an RNA Extraction Kit according to the manufacturer’s instructions (#9767, TaKaRa, Japan). The extracted RNA concentration was measured using a Nanodrop 2000 spectrophotometer (#ND-LITE ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The immunoglobulin PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Cell Biology 2019Quote: ... of mouse E2F1 gene and the resultant fragment was ligated between the BamH1 and Xba1 sites of the pQXCIP vector (Clontech). pQCXIP/N-m (or h)E2F1p::pE2VF1-3’UTR ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-ORF1p (guinea pig, 1/200, in-house, clone 09 as in 83, anti-mCherry (mouse, 1/200, Clontech 632543), rabbit anti-H3K9me3 (rabbit ...
-
bioRxiv - Cell Biology 2021Quote: ... pDAA-026 was generated by subcloning a DNA fragment encoding an N-terminus FLAG-tagged mouse eIF2α coding sequence flanked by BamHI and EcoRI sites into the BglII and EcoRI sites of pLPCX (Clontech) using standard molecular biology methods ...
-
bioRxiv - Neuroscience 2021Quote: Total RNAs from the mouse forebrain were reverse transcribed using the PrimeScript II first strand cDNA Synthesis Kit (Takara Bio) with the random hexamer primer ...
-
bioRxiv - Immunology 2020Quote: ... 10ng of RNA was used to prepare bulk TCR-seq libraries using the SMARTer Mouse TCR a/b Profiling Kit (Takara) according to instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were subjected to 4-20% SDS-PAGE and analyzed by immunoblotting with the following primary antibodies: anti-GFP mouse monoclonal antibody (JL-8, Takara), GFP rabbit polyclonal antibody (PABG1 ...
-
bioRxiv - Neuroscience 2022Quote: ... These plasmids were obtained by cloning cDNA extracted from mouse cerebellum in pAAV-MCS Expression Vector with In-Fusion Cloning system (Takara). 96h after transfection ...
-
bioRxiv - Biophysics 2023Quote: ... A plasmid expressing mouse GR tagged in the N-terminus with mCherry was developed by amplifying mouse GR coding sequence and in-frame cloning in pmCherry-C3 (Clontech). Point mutations and deletions were introduced using the Quickchange XL mutagenesis kit (Agilent ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Bioengineering 2022Quote: ... Sections were incubated overnight at 4°C in primary antibody diluted in PBS (1:100 monoclonal mouse anti-GFP; 632380, Clontech). After washing with PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... was generated by amplifying full-length mouse ANGPTL4 cDNA (OpenBiosystems) and inserting it into a pCDNA6 vector using In-Fusion cloning (Clontech). A V5 tag was then appended to the C terminus of the open reading frame using Phusion site-directed mutagenesis (New England Biolabs).
-
bioRxiv - Immunology 2023Quote: ... A cDNA library for TCR was prepared from RNA using a SMARTer Mouse TCR a/b Profiling Kit (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: Full-length mouse Rnf212b and Rnf212 cDNAs were amplified by PCR from mouse testis cDNA prepared as above and cloned into pGADT7 and pGBKT7 vectors (Clontech) using the Gibson Assembly Cloning Kit (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA encoding ZP3 was restored from the mouse ovarian tissue by RT-PCR using PrimeScript RT Reagent Kit (Takara, RR037). Two PCR amplicons including the 5′ region of the TECTA-ZP and the transmembrane domain (TMD ...
-
bioRxiv - Microbiology 2023Quote: Sequence of the mouse variable heavy and kappa chains were obtained by using SMARTer 5’ RACE technology (Takara Bio, USA) adapted for antibodies to amplify the variable genes from heavy and kappa chains for each hybridoma based on isotype ...
-
bioRxiv - Immunology 2024Quote: The full-length cDNA of mouse CCL2 (NM_011333.3) was amplified by PCR with PrimeSTAR Max DNA Polymerase (Takara Bio, #R045A) from mouse MCP-1/CCL2 cDNA ORF Clone (Sino Biological ...
-
bioRxiv - Cell Biology 2024Quote: We cloned a 1.6 kb genomic region upstream from start codon of mouse Lmna as the endogenous promoter (-1407 to +249 bp from transcription start site) using PrimeSTAR HS DNA Polymerase (Takara). Primers used in this study are listed in Table S2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech, Franklin Lakes, NJ, USA) with enzymes XhoI and BamHI replacing the tubulin sequence ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Cell Biology 2021Quote: ... An adult mouse retina cDNA library was cloned in pGADT7 (carrying a Trp1 selection gene) and transformed in AH109 yeast strain (containing His3, Ade2, lacZ and Mel1 selections; Clontech, BD Biosciences, Pao Alto, CA). Cpne4 vWA domain was cloned into pGBKT7 (carrying Leu2 selection gene ...
-
bioRxiv - Neuroscience 2019Quote: ... and then incubated with a GFP antiserum (rabbit, 1:1000, Life Technology, #A6455) or an mCherry antiserum (mouse, 1:1000, Clontech, #632543). Primary antisera were diluted in PBS with 2% NGS overnight at 4°C ...
-
bioRxiv - Bioengineering 2019Quote: ... MO). The horseradish peroxidase (HRP)-conjugated monoclonal anti-His antibody (anti-mouse Cat. #631210) was obtained from Clontech (Mountain View, CA). The ultrasensitive HRP substrate used for Western blotting was from TaKaRa (Shiga ...