Labshake search
Citations for Takara Bio :
601 - 617 of 617 citations for Recombinant Human MAPK1 GST tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... PCR amplification allowed to obtain the coding sequence for human HSF1 that was cloned into peGFP N3 vector (Clontech Laboratories Mountain View, CA); the plasmid was then verified by sequencing (GATC Biotech ...
-
bioRxiv - Immunology 2022Quote: ... Viruses were packaged in human embryonic kidney (HEK) 293 cells and viral supernatants were processed using Retro-X concentrators (Takara Bio. USA Inc). Naïve CD8 T cells were purified by negative-selection and stimulated in vitro with plate-bound anti- CD3/CD28 ...
-
bioRxiv - Neuroscience 2021Quote: ... under control of the modified human GFAP promoter, GfaABC1D (Lee et al., 2008) using restriction cloning and In-Fusion HD assembly (Clontech, Takara Bio, USA). The following sequence elements were obtained from Addgene ...
-
bioRxiv - Biochemistry 2021Quote: A cDNA fragment encoding full-length human EGFR (UniProt accession no. P00533) was cloned into the pEGFP-N1 plasmid (Clontech, Mountain View, CA). To facilitate affinity purification ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Cell Biology 2022Quote: Mouse NIH/3T3 (ATCC, cat# CRL-1658), human IMR-90 (ATCC, cat# CCL-186) and Lenti-X™ 293T (Takara Bio, cat# 632180) cell lines were cultured in full-DMEM (Corning ...
-
bioRxiv - Cell Biology 2024Quote: ... A bicistronic construct expressing human EPAC1b with a C-terminal His10 tag and SUMO3(Q89K) was constructed using the pIRES2-EGFP vector (Clontech Catalog no. 632435). The EPAC1-His10-IRES-SUMO3(Q89K ...
-
bioRxiv - Neuroscience 2022Quote: Human embryonic stem cell (hESC)-derived cerebral organoids (hCOs) were generated from a commercially available hESC stem cell line (Takara Bio, Osaka, Japan), using the STEMdiff cerebral organoid kit (STEMCELL Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1.25Lμg pVSV-G (second-generation lentivirus packaging system) into human embryonic kidney packaging cells GP2-293 (Clontech, Inc., Mountain View, CA, USA), using CalPhos™ Mammalian Transfection Kit (Clontech ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The Northern dot blots containing cDNAs from primary human tumors (T) with paired adjacent normal tissues (N) and cancer cell lines were obtained from Clontech (Cancer Profiling Array, #7840-1). The blots contained normalized cDNA isolated from tumors and the corresponding adjacent normal tissues from individual cancer patients ...