Labshake search
Citations for Takara Bio :
601 - 650 of 5155 citations for Mouse Short Coiled Coil Protein SCOC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The extracted probes were radioactively labeled with 2.5 μl [alpha-32P] dCTP (Amersham) according to the instructions of the kit (LaddermanTM Labeling Kit, Takara). The probe was mixed with 100 μl TE buffer (10mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... library preparation was performed using the SMARTER Stranded Total RNA Seq kit v2-Pico Input Mammalian kit (Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The blots were incubated overnight at 4°C with a mouse anti-GFP antibody (RRID:AB_2323808, 63281, Clontech) at a 1:2,000 dilution in blocking buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... mouse ESCs were seeded on a gelatin coated dish and cultured in the NDiff 227 medium (TAKARA) for 5 days33 ...
-
bioRxiv - Cell Biology 2020Quote: Antibodies used in this study were as follows: mouse anti-GFP (JL-8, dilution 1:1000) (Clontech); Alexa 488- ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated in primary antibody (1:1,000 mouse anti-calbindin, Sigma; 1:500 rabbit anti-DsRed, Clontech; 1:1,000 guinea pig anti-vGluT1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The following primary antibodies were used: mouse anti-Nc82 (Laissue et al., 1999) rabbit anti-DsRed (TaKaRa Bio ...
-
bioRxiv - Molecular Biology 2023Quote: ... The GFP-mCDCA7 construct was generated by cloning mouse Cdca7 cDNA into the pEGFP-C1 vector (Clontech). The GST-mCDCA7 CRD (pXC2025 ...
-
bioRxiv - Cell Biology 2023Quote: ... The following antibodies were used for the study: mouse anti-GFP (632381, JL-8, Clontech, 1:1000), rabbit anti-mCherry (GTX128508 ...
-
bioRxiv - Microbiology 2023Quote: ... Standard immunoblotting procedures were performed using a primary antibody against GFP (mouse monoclonal JL-8 antibody, Takara) and a secondary antibody goat anti-mouse IgG-peroxidase antibody (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
bioRxiv - Plant Biology 2021Quote: ... All Rec and Rad proteins were translationally fused with the Activation Domain (AD) of pGADT7 AD (Takara Bio). βC1 was fused with Binding Domain (BD ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA isolation and reverse transcription were performed as described in the STAR METHODS section “Ddi2 expression analysis in mouse embryos using qRT-PCR.” Constructs encoding the DDI2WT and DDI2PD proteins were cloned into p905 (gift from Pavlína Řezáčová, IOCB CAS, Prague) and pTreTight (Clontech) expression vectors.
-
bioRxiv - Developmental Biology 2022Quote: ... The expression of Dunk protein was confirmed by Western blot using c-Myc Monoclonal Antibody (Takara, Cat# 631206). Then ...
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Plant Biology 2022Quote: ... bait and linker proteins were cloned into the appropriate position of the pBridge vector (Clontech, Mountain View, California), which encodes a GAL4 DNA binding domain and a linker protein ...
-
bioRxiv - Cell Biology 2023Quote: ... Cre recombinase proteins were delivered into TP53-missense mutation knock-in cells using Cre Recombinase Gesicles (Takara Bio).
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged CRONE protein was purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified MBP-mEGFP/mCherry-Seb1 and MBP-mEGFP/mCherry-Rhn1 proteins were incubated with HRV 3C protease (Takara; 1 U/1 g of target recombinant proteins ...
-
bioRxiv - Plant Biology 2024Quote: ... The PLT2-GFP fusion protein abundance was detected by using anti-GFP (cat#632381, 1:3,000 dilution; Clontech) and anti-ACTIN (cat#MA1-744 ...
-
bioRxiv - Microbiology 2024Quote: ... and the protein was purified using cobalt affinity resin (1mL/L culture, Takara Bio USA, San Jose, CA). The protein was washed with 100 mM NaCl ...
-
bioRxiv - Cell Biology 2019Quote: Total RNA was isolated (HiPure Plant RNA MIni Kit, Magen) and reverse transcribed (The PrimeScript® RT reagent Kit, Takara). Two pairs of primers (5′-GGCAAGAATCATCACGACCAG-3′ and 5′-GTATGCCATGAGGTCGTCCAC-3′ ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from wing discs of individual silkworms at the wandering stage using the MicroElute Total RNA Kit (OMEGA) and reverse transcription was performed using the PrimeScript RT reagent Kit (Takara). qRT-PCR experiments were performed using Hieff SYBR Green Master Mix (YEASEN) ...
-
bioRxiv - Microbiology 2021Quote: ... Remaining DNA was removed using the TURBO DNA-free kit (Thermo-Scientific) and cDNA generated using the PrimeScript cDNA synthesis kit (Takara). qRT-PCR reactions were set up according to the manufacturer’s instructions (Alkali Scientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were prepared using the SMART-Seq v3 Ultra Low RNA Input Kit for Sequencing and the Low Library Prep Kit v1 from Clontech. For the an3 RNAseq experiment ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cDNAs were produced using BioRad Reverse Transcription Kit (iScriptTM Reverse Transcription Supermix) or the PrimeScript RT reagent kit (RR037A, TaKaRa). cDNAs from HEK and THP89 cells were quantified by quantitative PCR using Bio Rad’s SsoAdvanced Universal SYBR Green Supermix ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA with RIN > 7 was prepared for sequencing using the RNAseq Ovation V2 kit (Nugen) or Smart-seq 4 low-abundance RNA kit (Takara) and sequenced on the Illumina HiSeq 4000 or Novaseq 2 platform in collaboration with Oxford Genomics Centre.
-
bioRxiv - Microbiology 2020Quote: ... Total viral DNA was extracted using Qiagen viral DNA extraction kit (QIAamp DNA Mini Kit, Hilden, Germany) and DNA polymerase Tag (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... and indexing were performed as previously described using the Qiagen AllPrep DNA/RNA Micro Kit and the SMARTer Stranded Total RNA-Seq Kit v2 (Takara) (46 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Directional libraries were prepared using the Smarter Stranded Total RNA-Seq kit-Pico Input Mammalian kit following the manufacturer’s instructions (Clontech, 635005). The quality of all libraries was verified with the DNA-1000 kit (Agilent ...
-
bioRxiv - Neuroscience 2019Quote: ... cDNA synthesis and library preparation was performed using the SMART-Seq v4 Ultra Low Input RNA Kit and Low Input Library Prep Kit v2 (Clontech), respectively ...
-
bioRxiv - Neuroscience 2019Quote: ... cDNA synthesis and library preparation was performed using the SMART-Seq v4 Ultra Low Input RNA Kit and Low Input Library Prep Kit v2 (Clontech), respectively ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the manufacturer specifically states they should not occur in RNA-Seq reads if used in combination with the Nextera XT DNA library preparation kit (Appendix C in SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing User Manual, Takara Bio Inc ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA libraries were prepared with the Trio RNA-seq + UDI Library Preparation Kit (NuGEN) or the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Clontech) and sequenced on the MiSeq ...
-
bioRxiv - Microbiology 2023Quote: ... Remaining DNA was removed using the TURBO DNA-free kit (Thermo-Scientific) and cDNA generated using the PrimeScript cDNA synthesis kit (Takara). qRT-PCR reactions were set up according to the manufacturer’s instructions (Alkali Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... A total of 3.5 μl ribo-depleted material was used for SMARTer (SMARTer PCR cDNA Synthesis Kit, catalog num. 634926 and Advantage 2 PCR kit, catalog num. 639207, Clontech-Takara) protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Isolated RNA was dissolved in 10 μl of DEPC-treated water and reverse-transcribed using a reverse transcription reagent kit (PrimeScript RT Reagent Kit with gDNA Eraser, Takara) and a thermal cycler (Mastercycler ...
-
bioRxiv - Neuroscience 2024Quote: ... Sequencing libraries were prepared using “SMARTer Stranded Total RNA-seq Kit v3 – Pico Input Mammalian” kit (Takara Bio, Cat. # 634487) and the “SMARTer RNA Unique Dual Index Kit - 24U” (Takara Bio ...
-
bioRxiv - Cancer Biology 2024Quote: ... The full-length cDNA of the human ZNRF3 was acquired from the human CRC DLD-1 cell line by RNA purification using NucleoSpin RNA II kit (Macherey Nagel) and reverse transcription RT-PCR using specific primers and Primescript RT reagent kit (TaKaRa). Then the ORF of the ZNRF3 short variant replaced RNF43 and was assembled into the C-terminal FLAG-tagged vector using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted using a NucleoSpin RNA kit (Macherey Nagel) and reverse transcribed with the Primescript RT reagent kit (TaKaRa) according to the manufacturer’s instructions ...