Labshake search
Citations for Takara Bio :
601 - 650 of 958 citations for Dengue Virus Serotype 3 DIII envelope protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Protein bands were detected by Western blot using a commercial 6xHis monoclonal antibody (631212, Clontech) and a goat anti-mouse IgG (H + L)-HRP conjugate (1706516 ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant proteins of interest were bound to TALON metal affinity beads (Clontech, Mountain View, CA) and eluted with imidazole (gradient 10–200 mM ...
-
bioRxiv - Microbiology 2021Quote: ... protein expression was induced with 1 mM of isopropyl-β-D-thiogalactopyranoside (IPTG; Takara Bio) at the final concentration at 25°C ...
-
bioRxiv - Biophysics 2021Quote: ... The solubilized protein was incubated with 2 mL TALON cobalt metal-affinity resin (Takara Bio) for 1 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... The RNA-binding protein expressing vector was based on the shuttle vector pGADT7 (Clontech, USA) and constructed as described previously [25] ...
-
bioRxiv - Microbiology 2020Quote: ... to remove cellular debris and the protein was column-purified using anti-histidine resin (ClonTech). The resin was washed ten times with 10x column volumes of wash buffer mixed with an increasing proportion of tris buffer (20 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... the protein was affinity purified using TALON cobalt affinity resin (Clontech Laboratories, Mountain View, CA) followed by size exclusion chromatography on Superdex 200 10/30 GL size exclusion column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... His6-tagged protein in the supernatant was captured on Talon Sepharose beads (#635502, Clontech/Takara) and pre-equilibrated against Buffer1 (300 mM NaCl ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... His6-tagged protein in the supernatant was captured on Talon Sepharose beads (#635502, Clontech/Takara) and pre-equilibrated against Buffer1 (300 mM NaCl ...
-
bioRxiv - Evolutionary Biology 2022Quote: CDS sequence coding protein BmMETTL3(204-329) was cloned into the Pcold vector (TaKaRa, China). Primers were listed in Table S1 ...
-
bioRxiv - Plant Biology 2022Quote: ... Proteins were purified by immobilized-metal affinity chromatography using TALON® metal affinity resin (Clontech), where filtered supernatant (0.45 μm filter ...
-
bioRxiv - Neuroscience 2022Quote: 50 µg of human cerebral cortex lysate (Protein Medley, Takara, Kusatsu, Japan, Cat. No. 635323) were diluted and prepared according to manufacturer’s instructions (protocol PT1602-1) ...
-
bioRxiv - Molecular Biology 2022Quote: The respective sequences of the proteins were cloned into pGBKT7 and pGADT7 vectors from Clontech which harbor either the DNA binding domain or activation domain at the N-termini ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein concentration was measured using a BCA assay kit (Takara Bio Inc., Kusatsu, Siga, Japan). Twenty micrograms (µg ...
-
bioRxiv - Biophysics 2023Quote: ... the protein was affinity purified using TALON cobalt affinity resin (Clontech Laboratories, Mountain View, CA) followed by size exclusion chromatography on Superdex 200 10/30 GL size exclusion column (GE Healthcare ...
-
bioRxiv - Bioengineering 2023Quote: ... Proteins were purified from the soluble cell lysate using His60 Ni Superflow Resin (Takara Bio) and concentration was measured using NanoDrop ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified from Escherichia coli BL21 (DE3) with TALON Metal Affinity Resin (Takara), Pierce Glutathione Agarose (Thermo scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... Purification of the His6-tagged protein was achieved by TALON® spin columns (Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The secreted dystroglycan protein DAG128–749R311A/R312A was purified using His60 Ni IMAC resin (Takara) and subjected to anion exchange using DEAE resin ...
-
bioRxiv - Biophysics 2024Quote: ... The protein was purified to homogeneity using a combination of TALON Metal Affinity Resin (Takara) and gel filtration chromatography ...
-
bioRxiv - Microbiology 2024Quote: ... The fusion protein was affinity-purified using TALON Metal Affinity Resin (Takara Biosciences; Table S4) and eluted in buffer containing 25 mM HEPES ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proteins were then purified using TALON metal-affinity resin (Clontech, Mountain View, California, USA) previously added and washed in PBS according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: The Upf1-HD-His6 wild-type protein was first purified on a TALONTM resin (Clontech) equilibrated with buffer A200 ...
-
bioRxiv - Cell Biology 2020Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′-GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... Specific forward and reverse primers (Suppl Table 3) were designed using the In-Fusion Cloning Primer Design Tool from TaKaRa (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting plasmids were co-transformed into Saccharomyces cerevisiae strain AH109 according to the protocols in the Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The yeast cells were cultured on SD/-Leu-Trp (-LW ...
-
bioRxiv - Molecular Biology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [18] (ii ...
-
bioRxiv - Genomics 2019Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′ -GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... reverse transcription was initiated from the bridge 3’ OH by adding 2 μL SMARTScribe Reverse Transcriptase (100 U/ μL, Clontech) and incubating for 1 h at 42 °C with shaking at 800 rpm ...
-
bioRxiv - Pathology 2020Quote: ... The PCR assay was conducted as described previously9 and the complete genome termini was determined using the Takara SMARTer RACE 5’/3’ kit (TaKaRa) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... Primers P5 and P6 were annealed to create a dsDNA molecule encoding the sgRNA sequence with 5’ and 3’ extensions to enable InFusion Cloning (Clontech) into BtgZI-digested pL6 ...
-
bioRxiv - Microbiology 2019Quote: ... the NS3 fragments with FLAG-tag and NS3 cDNA vector were ligated together at an approximate molar ratio of 1:3 using TaKaRa DNA Ligation Kit LONG (TAKARA) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... Lentiviral particles were concentrated from supernatant by mixing 3 parts supernatant with 1 part Lenti-X concentrator solution (ClonTech 631231), incubating overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5’ and 3’ RACE was carried out according to the manufacturer’s protocol of SMART RACE cDNA Amplification kit (Clontech, Takara, Japan). The sequences of primers for RACE are as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... interaction test and plasmid isolation were performed using the Yeast Protocols Handbook and Matchmaker GAL4TM Two-hybrid System 3 & Libraries User Manual (Clontech).
-
bioRxiv - Microbiology 2021Quote: ... CPER fragments containing WT or mutated or 3’UTRs were amplified from the plasmids using PrimeStar GXL polymerase (Takara, Japan) and gel-purified ...
-
bioRxiv - Plant Biology 2020Quote: ... The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196) and Atcox1-3’(+17..+38) using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4 minute-denaturation at 95°C ...
-
bioRxiv - Microbiology 2021Quote: Evaluation of protein interactions by the GAL4-based Y2H system was performed by following the manufacturer’s recommendations for the Matchmaker GAL4 Two-hybrid System 3 (Clontech, USA). Competent AH109 yeast cells (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [3] ...
-
bioRxiv - Microbiology 2020Quote: ... was co-transformed with different bait-prey combinations as indicated in Extended Data Fig.1 in accordance with instructions for Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The transformed yeast was then screened in 4-dropout plates for the protein-protein interaction.
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Biophysics 2020Quote: Target DNA containing the 5′-TTTA-3′ PAM was ordered from IDT and cloned into a pET28-MHL vector using the In-Fusion Cloning Kit (ClonTech). Plasmids were linearized before usage ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCRs (sqPCRs) were performed on 3 μl of cDNA template using Emerald Amp Max PCR Master Mix (Takara). The sequences of the primers used for PCR amplifications are included in Supplemental Table 4.
-
bioRxiv - Plant Biology 2022Quote: ... and pMKMM21 (3.5 kb upstream SYP12A:5’UTR:miniTurbo- Myc-SYP12A:3’UTR) were generated by in-fusion cloning (HD enzyme mix; Takara Bio). Gateway binary vectors pMKMM22 and pMKMM23 for the expression of miniTurbo-Myc- MpSYP13B and miniTurbo-Myc-MpSYP12A were generated by LR-recombination (LR clonase ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... cerevisiae strains used for yeast two-hybrid analysis were Y187 (MATα, ura3-52, his3-200, ade2-101, trp1-901, leu2-3, 112, gal4Δ, met–, gal80Δ, URA3::GAL1UAS-GAL1TATA-lacZ; Clontech) and Y2H Gold (MATa ...