Labshake search
Citations for Takara Bio :
601 - 650 of 1390 citations for 8 8 dimethylpyrano 2 3 h chromen 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... by using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara) and host RNA-specific primers (Supplementary Table S3) ...
-
bioRxiv - Physiology 2023Quote: For Matchmaker Gold yeast one-hybrid system (Clontech, Mountain View, CA, USA), the MaMYB4 CDS was fused to the GAL4 transcription factor activation domain (GAL4AD ...
-
bioRxiv - Plant Biology 2021Quote: Yeast strain AH109 was transformed with bait (pGBKT7) and prey (pGADT7) constructs by following the small scale yeast transformation protocol from Yeastmaker™ Yeast Transformation System 2 (Clontech). Upon transformation ...
-
bioRxiv - Genomics 2020Quote: ... and the resulting DNase I-treated RNA (~2 ng) was processed for sequencing by using a SMART-Seq v4 Ultra Low Input RNA kit (Takara Bio) according to the manufacturer’s protocol with 12 cycles of PCR followed by two rounds of clean up with 1.3X Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The first stranded cDNA was next amplified to produce double stranded cDNA in 20 amplification cycles by long distance PCR using the Advantage 2 polymerase mix (Takara, Clontech) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: For the V1 protocol 20 µL of pooled and ExoI treated cDNA was PCR amplified with Advantage 2 Polymerase Mix (Clontech, #639206) in 50 µL total reaction volume using 1 µL of 10 µM LA_oligo (Microsynth ...
-
bioRxiv - Genomics 2020Quote: ... PCRs were performed on board using 25 ng of DNA from each coral sample with the Advantage 2 kit (Takara Clontech) and a final primer concentration of 0.5 μM in a final reaction volume of 50 μl ...
-
bioRxiv - Genomics 2021Quote: ... were used for library construction using the SMARTer Stranded Total RNA-Seq Kit v.2 (634418, Pico Input Mammalian, Takara/Clontech, Japan) according to the manufacturer’s protocol without RNA fragmentation ...
-
bioRxiv - Genomics 2020Quote: ... 2 μg of total RNA per sample was used to generate first-strand cDNA using reverse transcription system (Takara, Dalian, China). Quantitative RT-PCR was performed using SYBR Premix Ex Taq (Takara ...
-
bioRxiv - Immunology 2021Quote: ... Single stranded cDNA was synthesized immediately by adding 0.7 µl SMARTScribe reverse transcriptase (100 U/µl, f/c 2 U/µl, Takara Bio #639537), 7 µl First-Strand buffer (f/c 1×) ...
-
bioRxiv - Bioengineering 2020Quote: ... The lysate was loaded onto a prepared column with 2 mL TALON Metal Affinity Resin (Clontech Laboratories, Inc., Mountain View, CA). After being washed twice with 5 column volumes (CV ...
-
bioRxiv - Systems Biology 2020Quote: ... proteins in whole cell extract and immunoprecipitated fractions were digested with 2 mg/mL proteinase K (Takara Bio Inc., Kusatsu, Japan) at 42°C for 2 h ...
-
bioRxiv - Cell Biology 2021Quote: γ2 mCherry and tethered GluA2 (flop isoform)::γ260 were subcloned into the doxycycline-inducible expression vector pBI-Tet (Clontech, #6152-1) using the restriction sites MluI/XbaI and MluI/NheI ...
-
bioRxiv - Cancer Biology 2021Quote: We quantified mRNA expression levels of IL-10 and chemokines identified in the RNA-Seq analysis using 2-step real-time RT-PCR (Thermal Cycler Dice Real Time System, Takara Bio). The ribosomal protein L13a (RPL13A ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were transfected with plasmids expressing either SARS-COV-2 S protein WT or mutants (E1182K, L1193G, E1182K/L1193G, L1182K/L1186G/L1193G) by using Calcium phosphate transfection kit (Takara-Bio). 24 h post transfection ...
-
bioRxiv - Microbiology 2021Quote: ... The copy number of viral RNA was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, cat# RC300A). The fluorescent signal was acquired using a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... whereas a TOPBP1 fragment corresponding to residues 2-1523 was amplified from pCDNA5-FRT/TO-LacR-FLAG-TopBP1 and cloned into pGBKT7 (Clontech/Takara) to create a fusion with the GAL4 DNA binding domain using the NdeI and XmaI sites ...
-
bioRxiv - Genetics 2019Quote: ... The pure linearized vector and the elpc-2 promoter were fused using an In-Fusion HD Cloning Kit (Takara, Kusatsu, Japan) to make the elpc-2p::GFP transcriptional reporter construct ...
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μl sense and 1 μl anti-sense primers of 100 μM each were mixed with 2 μl 10X Taq polymerase PCR buffer (Takara, Japan) and 16 μl ultra-pure water to a final volume of 20 μl ...
-
bioRxiv - Molecular Biology 2019Quote: ... with a universally tailed poly-dT primer and a template switching oligo followed by amplification for 12 cycles with the Advantage 2 DNA Polymerase (Takara Bio). After ultrasonic shearing (Covaris LE220) ...
-
bioRxiv - Immunology 2021Quote: ... was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio). pSFG-SARS-CoV-2 S D614G was cloned from pSFG-SARS-CoV-2 S plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs) ...
-
bioRxiv - Microbiology 2021Quote: ... real-time RT-PCR was performed with SARS-CoV-2 N primer sets and SYBR Premix Ex Taq II (TaKaRa-Bio) using a LightCycler Nano (Roche ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR reactions were performed in a 25μl-reaction mixture containing 12.5μl of 2 × Gflex PCR Buffer (Mg2+, dNTP plus) (TaKaRa Bio Inc., Shiga, Japan), 0.5μl of Tks
-
bioRxiv - Physiology 2021Quote: ... Frozen placental biopsies (25mg) were homogenized using a 2 ml Kimble dounce tissue grinder and nuclei pellets resuspended in Nuclei Suspension Buffer (Clontech #2313A) before filtering through a 40μm cell strainer ...
-
bioRxiv - Microbiology 2021Quote: ... The copy number of viral RNA was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). The fluorescent signal was acquired using a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... foetal bovine serum or 10% (v/v) TET System–approved FCS for U–2–OS reporter cell lines (631106, Takara Bio). U–2–OS-pEP15 cells (5 ...
-
bioRxiv - Molecular Biology 2020Quote: Yeast-2-hybrid assays were performed with the plasmids and strains from the Matchmaker Gold Yeast Two-Hybrid System (Takara Bio) according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... Double-strand cDNA was amplified by long-distance PCR (LD-PCR) using an Advantage 2 PCR kit (Clontech, cat. no. 639206).
-
bioRxiv - Microbiology 2021Quote: ... The amplified PCR product was verified by sequencing and then cloned into modified XW55 yeast dual expression vector65 in the highlighted SpeI and PmlI sites downstream of the ADH2 promoter by yeast recombinase technology [protocolYeastmaker™ YeastTransformation System 2 (Clontech)] and according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfection medium was replaced with 2 ml of reduced serum culture medium (5% FCS) supplemented with 300 μM A/C heterodimerization agent (formerly AP21967, Takara BioInc), 20 mM HEPES and 10 μM cholesterol (balanced with methyl-β-cyclodextrin ...
-
bioRxiv - Molecular Biology 2022Quote: ... serving as homology arms for directional cloning of the library into RD-seq plasmid (zfh1-DSCP-Gal4-DBD, Suppl. Table 2) vector using In-Fusion HD (Clontech 639650).
-
bioRxiv - Genomics 2022Quote: The genomic DNA of Mir-0 accession (ID 8337) was used as a template (2 ng) for amplification using PrimeSTAR® GXL DNA Polymerase (TaKaRa), in a 40-µl PCR reaction with 0.3 µM primers OP009 and OP010 ...
-
bioRxiv - Microbiology 2022Quote: ... These fragments were cloned into pUC19 with the HYG resistance cassette upstream of pCTR4-2 with InFusion cloning (Takara, Cat#638911). Plasmids were isolated from individual clones and confirmed by digestion with HindIII (New England Biolabs ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... in a 20 µL reaction consisting of 10 μL of TB Green Premix Ex Taq 2 (TliRNaseH Plus; TaKaRa, Dalian, China), 1 µL each of forward and reverse primer ...
-
bioRxiv - Plant Biology 2022Quote: ... Each of the up-regulated genes (MpGSTF7, MpGSTF10, MpGSTF15, MpCYP813A5, MpCYP822A1) was PCR amplified from genomic Tak-2 DNA using CloneAmp HiFi Premix (Takara Bio). The primers used to amplify gene sequences are listed below ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA (1–2 µg) was reverse transcribed using random hexamers and the PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa). RT-qPCR was performed using a StepOnePlus qPCR system (Applied Biosystems ...
-
bioRxiv - Biochemistry 2022Quote: ... KM881710.2) were PCR amplified from viral cDNA templates (31–33) and cloned into pSUMO expression plasmid by IN-FUSION (Takara Bio). The final constructs were confirmed by sanger sequencing performed by Genewiz.
-
bioRxiv - Genomics 2023Quote: ... A total of 3.5 μl ribo-depleted material was used for SMARTer (SMARTer PCR cDNA Synthesis Kit, catalog num. 634926 and Advantage 2 PCR kit, catalog num. 639207, Clontech-Takara) protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNAs were generated by PCR amplification in 50 µl-total reaction volume using the Advantage 2 PCR Enzyme System (Clontech, #639206). PCR reaction was performed using 20 µl cDNA from previous step ...
-
bioRxiv - Immunology 2023Quote: ... The mixture was then chilled on ice for 2 min and then mixed with 4 μl 5x first-strand buffer (Takara Bio), 2 μl 100 mM DTT ...
-
bioRxiv - Synthetic Biology 2023Quote: ... T cells were incubated at 3×104 cells/well in 96-well U bottom plates for 24 hours in T cell media containing 50 IU/mL rhIL-2 and varying concentrations of AP20187 (B/B homodimerizer, Takara, 635058). After 24 hours ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Activated T cells were transduced on day 1 after stimulation using combinations of PEG-precipitated retroviral concentrates encoding different constructs adsorbed onto non-tissue culture treated 6-well plates coated with anti-CD3/CD28 2 μg/mL each and retronectin 20 μg/mL (Takara, T100B) at 1-2×106 cells/well ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Cell Biology 2020Quote: ... Verification of positive colonies was achieved by co-transforming wild-type or YR-mutant TMEM39A loop domain (in pGBKT7 Vector) with genes of interest (in pGADT7 Vector) following the instruction of YeastMaker™ Yeast Transformation System 2 (Clontech, 630439) as well as plasmids from re-cloned cDNA.