Labshake search
Citations for Takara Bio :
601 - 650 of 2741 citations for 7 BROMO 2 3 4 5 TETRAHYDRO 1H BENZO E 1 4 DIAZEPINE 2 CARBOXYLIC ACID METHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... After high speed centrifugation (40 000 x g/40 min/4 °C) the supernatant was loaded on a HiTrap (GE) TALON Crude (Takara) metal affinity column ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA with RIN > 7 was prepared for sequencing using the RNAseq Ovation V2 kit (Nugen) or Smart-seq 4 low-abundance RNA kit (Takara) and sequenced on the Illumina HiSeq 4000 or Novaseq 2 platform in collaboration with Oxford Genomics Centre.
-
bioRxiv - Neuroscience 2020Quote: The cDNA libraries for used for sequencing of 4 total RNA samples were synthesized using a SMART-Seq Ultra Low Input RNA kit (Takara) in the OHSU Massively Parallel Sequencing Shared Resource Core Facility ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNAs encoding full-length human HCN1 channel and mouse TRIP8b (splicing variant 1a-4) were cloned into the pcDNA 3.1 (Clontech Laboratories) mammalian expression vector ...
-
bioRxiv - Biophysics 2020Quote: ... 6xHis-tagged protein fraction was incubated for thirty minutes at 4°C with Talon resin (Clontech Laboratories/Takara Bio USA) that had been previously equilibrated in lysis/extraction buffer ...
-
bioRxiv - Biophysics 2020Quote: ... 6xHis-tagged protein fraction was incubated for thirty minutes at 4°C with Talon resin (Clontech Laboratories/Takara Bio USA) that had been previously equilibrated in lysis/extraction buffer ...
-
bioRxiv - Neuroscience 2019Quote: ... 20μl cDNA solution per hemibrain was synthesised from 4-5g RNA using RNA-to-cDNA EcoDry Premix with random primers (Clontech), and was diluted 50-fold with distilled water.
-
bioRxiv - Developmental Biology 2021Quote: The reverse-stranded total RNA-seq libraries (Fig. 4 and Fig. S2A) were prepared using the SMARTer-Seq Stranded kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 × 106 HEK293T cells were transfected with 4 μg donor and 2.5 μg pX330 Cas9 plasmid (CalPhos™ Mammalian Transfection kit, Clontech). After 72 h ...
-
bioRxiv - Microbiology 2020Quote: ... Different amounts of total RNA (4, 16, 32, or 40 ng) were used for first strand synthesis using SmartScribe RT (Clontech) and Oligo(dT)23 VN primer (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... were added to the lysates of single parasites and libraries were prepared using SMART-Seq v.4 Ultra Low Input RNA Kit (Takara) using a quarter of the reagent volumes recommended by the manufacturer ...
-
bioRxiv - Genomics 2021Quote: ... Libraries from 4-cell embryos were also prepared using 18-30 nt gel purified RNA using the SMARTer smRNA-Seq Kit (Clontech) and NEXTflex-Small-RNA-Seq (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... linearized pUCHCPV-20-4 was used as a template for in vitro transcription by T7 RNA polymerase (TaKaRa, Dalian, China) to generate chimeric HDAC11-S4 RNA 4 ...
-
bioRxiv - Systems Biology 2024Quote: SW1353 cells were purchased from ATCC Full length miRNA target 3’UTRs were amplified from human genomic DNA using PCR primers (Supplementary Table 4) to enable Clontech In-Fusion HD cloning (Takara Bio Europe ...
-
bioRxiv - Neuroscience 2023Quote: ... Pelleted nuclei were then washed in 4 mL of Nuclei Suspension Buffer containing 0.2% RNase inhibitor (Clontech/Takara, Cat. 2313B) and centrifuged at 500xg for five minutes at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... The RT reaction mixture was prepared on ice and contained (per sample): 4 µL SmartScribe 1st Strand 5X buffer (Takara), 2 µL 100 µM DTT (Takara) ...
-
bioRxiv - Plant Biology 2023Quote: ... transferred membranes were hybridized overnight at 4 °C with the following primary antibodies: anti-GFP (Takara Bio Cat# 632381, RRID:AB_2313808) (1/5000) ...
-
bioRxiv - Neuroscience 2023Quote: ... Pelleted nuclei were then washed in 4 mL of Nuclei Suspension Buffer containing 0.2% RNase inhibitor (Clontech/Takara, Cat. 2313B) and centrifuged at 500xg for five minutes at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and re-plated at a concentration of 2.5×105 cells/cm2 onto plates coated with 4 μg/mL iMatrix-511 (Takara Bio) in N2B27 medium supplemented with 10 μg/mL BDNF and 10 µg/mL Rock Inhibitor Y-27632 ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR reaction was prepared using gene-specific primers (20µM, Eurofins, primer sequences in Suppl. Table 4) and PrimeSTAR® Max DNA Polymerase (Takara) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2024Quote: ... The supernatant with the protein was then separated by ultracentrifugation (60,000 rpm, 45 min, 4°C) and incubated overnight with Talon metal affinity resin (Takara Bio). The protein was affinity purified from the solubilized fraction in a gravity column (BioRad ...
-
bioRxiv - Biophysics 2022Quote: ... E-cadherin (24E10-Cell Signaling Technology; DECMA1-Sigma Aldrich, ECCD2, Takara Bio) (1:100)and paxillin (Abcam ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 2 μL of PBS including 0.2% Triton X-100 and 4U of RNase inhibitor (Takara) per well ...
-
bioRxiv - Cancer Biology 2021Quote: Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Membranes were baked for 2 h at 80°C and prehybridized in ExpressHyb (Clontech, Mountain View) at 65°C for 1h ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...
-
bioRxiv - Plant Biology 2021Quote: ... Co-transformants were selected by cultivation for 2 days on minimal synthetic defined (SD) media (Clontech) lacking Leu (pACT2-GW ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Molecular Biology 2021Quote: Primers were designed using the Takara Bio Perfect Real Time Support System (Takara Bio, Table 2). Primers were diluted to 50 µM in ddH20 and stored at -20°C ...
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using 2 μg RNA and PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viral supernatant was collected 2 days post-transfection and concentrated using Lenti-X lentivirus concentrator (Clontech). Cells were then infected with the concentrated lentivirus ...
-
bioRxiv - Neuroscience 2020Quote: ... 1/3 (v/v) of LentiX™ Concentrator reagent (Clontech, Mountain View, USA) was added and incubated overnight (o/n) ...
-
bioRxiv - Microbiology 2023Quote: ... HIV-1 NL4-3 Vpu ORF was cloned into pEGFP-N1 (Clontech, France). The ORF of human ATG5 was cloned in frame with HA tag into pAS1B vector (pAS1B-HA-ATG5) ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed for 1h at room temperature (RT) with a mouse anti-GFP antibody (Living Colors -JL-8, BD Biosciences Clontech) in TBS-T buffer (20 mM Tris ...
-
bioRxiv - Neuroscience 2024Quote: ... 7 million Lenti-X HEK-293T cells (Takara Bio, 632180) were seeded in 9 mL DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... and a linker sequence (5’-GGTAGCGGCAGCGGTAGC-3’) were added through three additional PCR reactions using PrimeStar GXL DNA polymerase (Takara Bio). PCR products were gel-purified in each step ...