Labshake search
Citations for Takara Bio :
601 - 650 of 1082 citations for 6 AMINO 2 5 DINITROPYRIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: CPT1a knockdown cell lines were generated using the shRNA-expressing lentiviral pLKO-shRNA2 vector (No. PT4052-5; Clontech), with a puromycin selection cassette ...
-
bioRxiv - Cell Biology 2023Quote: ... and used for library preparation (5-10 ng) using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech). Libraries were sequenced on Novaseq platform (Illumina).
-
bioRxiv - Bioengineering 2023Quote: ... T cells were mixed with lentivirus at multiplicity of infection (MOI) equal to 5 in Retronectin (Takara, T100B)-coated culture plates and centrifuged at 1800 g for 1 h at 32 °C for lentiviral transduction before returning to normal culture condition ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were diluted in 5% milk in PBS-T + 0.01% sodium azide (1:2,000 for mouse anti-GFP (Clontech) and mouse anti-3V5 (Invitrogen) ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 2 μL of PBS including 0.2% Triton X-100 and 4U of RNase inhibitor (Takara) per well ...
-
bioRxiv - Cancer Biology 2021Quote: Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 mM MgCl2 and 2 μl of CIAP (Calf intestine AP, 30 U/μl: Takara#2250A). For the Endo H reactions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Membranes were baked for 2 h at 80°C and prehybridized in ExpressHyb (Clontech, Mountain View) at 65°C for 1h ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...
-
bioRxiv - Plant Biology 2021Quote: ... Co-transformants were selected by cultivation for 2 days on minimal synthetic defined (SD) media (Clontech) lacking Leu (pACT2-GW ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Molecular Biology 2021Quote: Primers were designed using the Takara Bio Perfect Real Time Support System (Takara Bio, Table 2). Primers were diluted to 50 µM in ddH20 and stored at -20°C ...
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Plant Biology 2022Quote: ... bHLH39-1 and bHLH39-2 fused to the BD were co-transformed into yeast Y2HGold (Clontech). Transformants were grown on SD-Leu-Trp plates ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Plant Biology 2023Quote: ... and gametandiopore of one-month-old Tak-1 and Tak-2 by NucleoSpin RNA Plant (Takara) or Monarch Total RNA Miniprep Kit (New England BioLabs ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were stained with anti-mouse E-cadherin monoclonal antibody ECCD-2 (1:100, Takara) for 16 h at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: ... and mCherry were isolated by PCR from various templates and inserted into the pGL4.23-(C120×5)-TATA vector with In-Fusion cloning (Clontech) according to manufacturer instructions using a 1:2 vector-to-insert ratio to generate optogenetic response plasmids ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR reaction mixture (10 μl total volume) included 5 μl SYBR Premix Ex Taq II (TaKaRa, Dalian, China), 3.5 μl ddH2O ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’-RACE and 3’-RACE reactions were performed with the Smart RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’ end regions of MIC14 and MIC15 were amplified using the SMART RACE cDNA Amplification Kit (Clontech BD) using total or poly(A)+tachyzoite RNA (strain RH ...
-
bioRxiv - Molecular Biology 2022Quote: ... bound RNAs were eluted via 30min incubation at 55°C in wash buffer supplemented with 0.5 μg/μL Proteinase K and 0.1% SDS and isolated using Qiazol/chloroform separation and NucleoSpin RNA columns (Takara). Luciferase control RNA is spiked in to each sample (5ng/sample ...
-
bioRxiv - Immunology 2022Quote: The sequence of anti-IFNγ was cloned from XMG1.2 hybridoma (ATCC) using SMARTer RACE 5’/3’ kit (Takara Bio). The 6xHis tagged anti-Dsg ...
-
bioRxiv - Cell Biology 2019Quote: pLL6-MYH12A construct was made by replacing 5’LTR promoter in pLL5.0 (Cai et al., 2008) with PTight promoter from pTRE-Tight Vector (Clontech) and inserting human MYH12A using EcoRI-BamHI cloning sites ...
-
bioRxiv - Biochemistry 2021Quote: ... prepared as described above was mixed with imidazole (5 mM) and 0.5 mL of Talon superflow metal affinity resin (Clontech) that had been equilibrated with buffer (as above for magnetic agarose) ...
-
bioRxiv - Microbiology 2021Quote: PDGFRβ-targeted sgRNA (5’-CCGGTGAGAGCCACCCTGACAGTG-3’) was cloned into the pGuide-it-ZsGreen1 vector (Takara, Biomedical Technology, Beijing, China). This plasmid could simultaneously express Cas9 ...
-
bioRxiv - Genomics 2022Quote: ... IgG and IgM 5’RACE AIRR-seq libraries were generated using the SMARTer Human BCR Profiling Kit (Takara Bio), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were maintained at 37 °C in a humidified atmosphere at 5% CO2 in DMEM 4.5g/L Glucose with UltraGlutamine media supplemented with 10% of Tet-free FBS (Clontech) and 1% penicillin/streptomycin.
-
bioRxiv - Cell Biology 2019Quote: ... a pFA6a-3’UTR-AfeI-5’UTR-scd2-kanMX-3’UTR (pSM2255) plasmid was generated by InFusion cloning (Clontech) of a pFA6a-based plasmid containing the yeast kanMX resistance cassette digested with KpnI and AscI ...
-
bioRxiv - Genomics 2021Quote: ... or SL medium (for E14-STNΔTsixP) and transduced the next day with 1ml of 5:1 concentrated (lenti-X, Clontech) and filtered viral supernatant with 8 ng/µl polybrene (Sigma Aldrich) ...
-
bioRxiv - Immunology 2021Quote: ... The supernatants were collected and applied to a column filled with 5 ml of TALON Metal Affinity resin (Takara) previously equilibrated with ice-cold PBS ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The template plasmid for the mCherry-targeting ssDNA was constructed with 1.5 kb long 5’ and 3’ arms amplified from the C57BL/6N genome using PrimeSTAR GXL DNA Polymerase (TaKaRa), the upstream genome sequence of the stop codon of Rtl5 and downstream of the predictive cut site by Cas9 ...
-
bioRxiv - Microbiology 2020Quote: 5’-RACE analysis was performed using SMARTer RACE 5’/3’ kit and In-Fusion HD Cloning kit according to the manufacturer’s instructions with slight modifications (Clontech). 5’-RACE ready cDNA was synthesized from purified mRNA (TG ...
-
bioRxiv - Immunology 2021Quote: ... 100,000 cells were sorted into 200 uL PBS with 1 uM DTT and 5 uL RNase Inhibitor Cocktail (Takara); for ex vivo culture experiments ...