Labshake search
Citations for Takara Bio :
601 - 650 of 992 citations for 5 Bromo 2 bromo difluoro methyl 1H benzimidazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The sgRNA target locus on exon 3 or 5 was PCR amplified with Terra™ PCR Direct Polymerase Mix (Takara) for 35 cycles using primer sets mEX3F and mEX3R or mEX5F and mEX5R (Table 1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the RNA was concentrated and reverse transcribed with a 5’-RACE protocol that appends a new primer site to the cDNA of both cleaved and uncleaved RNA (SMARTScribe, Takara). The cDNA was PCR amplified with primers that add the adaptors for Illumina sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: Rps29 5’UTR and coding region cDNAs were synthesised using SMART™ RACE cDNA Amplification Kit (Clontech Laboratories Inc. USA). PCR was performed using gene-specific primers (40S 5’ RACE R ...
-
bioRxiv - Systems Biology 2022Quote: ... Optimized coding sequences were synthesized as gBlocks (Integrated DNA Technologies) carrying 16-base pair overhangs at the 5’ and 3’ ends to facilitate in-fusion cloning (Clontech) into pET expression vectors (EMD MIllipore).
-
bioRxiv - Immunology 2022Quote: ... 25 μg of the retroviral expression vector (pLZRS-human codon-optimized Bcl6-P2A-human codon-optimized BclxL-IRES-GFP) and 5 μg of the envelope vector (p10A1; Clontech) were transfected into GP2-293 cells using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Genetics 2020Quote: ... The target vector and pEF1a-pac vector were co-transfected (5:1 ratio) to E14 mESCs using Xfect according to the manufacture’s instruction (TaKaRa, Inc). 48 hours after transfection ...
-
bioRxiv - Immunology 2020Quote: ... for 24 h and transduced with lentiviral particles by spinfection (1000 x g for 90 min at 32°C) in the presence of Polybrene (5 μg/ml) on the plates coated with Retronectin (50 μg/ml) (Takara/Clontech) and anti-CD3 (1–2 μg/ml) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The FOXR1 wild-type and M280L mutant were then PCR amplified using forward 5′-AAAGCACTCGAGATGGGGAACGAGCTCTTTCTG-3’andreverse5’-TTTGGCCCGCGGTTAAAGATCAAAGAGGAAGGG-3’ primers and subcloned into the XhoI and SacII restriction sites of pEGFP-C3 (Clontech) to create an N-terminal EGFP tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... was then added to the supernatant to a final concentration of 5 mM and the solution was subjected to immobilized metal affinity chromatography (IMAC) by incubation with TALON cobalt resin (Takara) for 1 hr at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Biophysics 2020Quote: ... containing either tetra-acetylated or unmodified histone H4 was digested for 5 min at 22 °C with micrococcal nuclease (MNase) (0.125 to 2.0 units; Takara, cat. #2910A) in 5.5 mM Tris-HCl buffer (pH 7.6 ...
-
bioRxiv - Genetics 2021Quote: ... The fragment length of PCR products was detected by 1.2% agarose gel electrophoresis using 5 μl of 100 bp DNA Ladder (TaKaRa, Japan) and gel stain (TransGen Biotech ...
-
bioRxiv - Cell Biology 2020Quote: ... with 5’-cgGAATTCaccATGgagcagaagctc atctcagaagaagacctcggtAAGGATAACACCGTGCC-3’ and 5’-ataagaatGCGGCCGCtaaact ATTATTTTTCTGCACTACGCAGG-3’ followed by cloning into the EcoRI and Not I sites of pIRESpuro3 (Clontech) creating pIRESpuro3-myc-BirA ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated by template-switch reverse transcription according to the SMARTer RACE 5’/3’ manual using the SMARTScribe Reverse Transcriptase (Takara) with a template-switch oligo including an 18-nucleotide unique molecular identifier (UMI) ...
-
bioRxiv - Immunology 2021Quote: ... 5′-GTGCATGCGGAAACACGTGTCTGG-3′ into pRRLU6-empty-gRNA-MND-Cas9-t2A-Puro vector or RNase L targeting gRNA 5′-GTTATCCTCGCAGCGATTGCGGGG-3′ into pRRLU6-empty-gRNA-MND-Cas9-t2A-Blast was achieved using the In-Fusion enzyme mix (Clontech). OAS1 and RNASEL KO 293T were generated using lentiviral transduction as described previously followed by selection in 2 μg/mL puromycin or blasticidin (Lau et al. ...
-
bioRxiv - Immunology 2020Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) using primers with specificity to IgM ...
-
bioRxiv - Microbiology 2023Quote: ... iBMDMs were seeded into 24-well plates (5×104 cells/well) and transfected with 600 ng and 1200 ng of the eukaryotic expression vector (pCMV-HA; Clontech) harbouring TcpB for 24-hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNAs (1-5 ng RNA equivalents) were used for real-time PCR amplification using SYBR Premix Ex Taq II (Takara/Clontech) on a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the NaCl concentration of the cleared lysate was adjusted to 500 mM and the cleared lysate was applied to 10 mL (=5 mL bed volume) equilibrated Talon SuperFlow Metal Affinity Resin (TaKaRa) per L culture on ice for 45 min ...
-
bioRxiv - Bioengineering 2022Quote: ... The solution was heated at 65°C for 5 minutes using Takara® PCR Thermal Cycler (Takara Corp., Shiga, Japan), and then gradually cooled down to 30°C over a time span of 10 minutes before settling down to 4 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries for RNA sequencing were prepared from 5 ng RNA/sample using the SMARTer Stranded Total RNA-Seq Kit v2 -Pico Input Mammalian (Takara) according to the manufacturer’s instructions using 12 PCR cycles for amplification ...
-
bioRxiv - Plant Biology 2023Quote: ... diluted to 1 µg/mL with Milli-Q ultra-pure water for 5 min at room temperature or with a pollen germination medium containing 2000-fold SYBR Green I (Cat#: 5760A, Takara) and 5 µg/mL DAPI (Cat# 10236276001 ...
-
bioRxiv - Microbiology 2023Quote: Sequence of the mouse variable heavy and kappa chains were obtained by using SMARTer 5’ RACE technology (Takara Bio, USA) adapted for antibodies to amplify the variable genes from heavy and kappa chains for each hybridoma based on isotype ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment coding GFP was inserted at the 5’ side of SYP32 by In-Fusion HD Cloning Kit (Takara), and the whole sequence was recombined into pGWB1 by LR Clonase II ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR purified integrin β5 with engineered flanking restriction sites (Xho-I/BamHI) was subcloned into the multi-cloning sites of pEGFP-N1 (Clontech) to encode an in-frame fusion protein with the carboxy-terminal EGFP-tag (pEGFP-N1-Integrin β5 ...
-
bioRxiv - Cell Biology 2022Quote: ... a polymerase chain reaction using 5’-TCTAGAGCTACTAACTTCAGCCTGCTG-3’ / 5’ - CGGTGGATCCCCTTCTTCC-3’ primers on Ibidi USA 60101 LifeAct-GFPtag2 plasmid was cloned with In-Fusion HD enzyme kit (Takara) into the pLVX vector (Clontech ...
-
bioRxiv - Genomics 2022Quote: Genomic DNA samples (5 ng) were used as templates in 20 μl reactions performed with PrimeSTAR GXL DNA Polymerase (TaKaRa), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Transferred membranes were blocked with 5% (w/v) milk for 30 mins at RT before being hybridized with the corresponding anti-GFP (632381, Takara) or anti-mCherry (632543 ...
-
bioRxiv - Immunology 2022Quote: ... Lentiviral transduction of murine alveolar macrophages was performed for 7 days in the presence of 5 μg/cm2 RetroNectin (Takara). Stable gene expression was confirmed by GFP signals using a BZ-X710 (KEYENCE ...
-
bioRxiv - Cell Biology 2023Quote: ... Up to 5 μl of assembly reactions were used for heat-shock transformation of Stellar™ Competent Cells (Takara Bio).
-
bioRxiv - Immunology 2022Quote: ... cDNA was generated from 10 μl RNA according to the SMARTer RACE 5’/3’ manual using SMARTScribe Reverse Transcriptase (Takara) and a self-designed template-switch oligo (AGGGCAGTCAGTCGCAGNNNNWSNNNNWSNNNNWSGCrGrGrG) ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... BBQ and FICZ as indicated at 37°C in 96-well plates for 5 days prior to measuring viability using WST reagent (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... RNA-seq libraries were generated from 5 ng of RNA with the SMART-Seq v4 Ultra Low Input RNA Kit from Takara Bio (#634889 ...
-
bioRxiv - Immunology 2024Quote: ... total RNA (0.5 ng) was added to reaction buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara), and reverse transcription was performed followed by PCR amplification to generate full length amplified cDNA ...
-
bioRxiv - Neuroscience 2024Quote: ... were designed using Primer3Plus (https://www.primer3plus.com/) and sequence accuracy was confirmed by SMARTer RACE 5’/3’ Kit (TaKaRa, Kusatsu, Japan) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified from 0.5 µl (5 ng) of a gene fragment in 20 µl using 2X CloneAmp HiFi PCR Premix (Takara Bio) with 250 nM of each primer TAATACGACTCACTATAGGCAATCCGCCCTCACTACAACCG and TCCCTCATCGACGCCAGAGTAG ...
-
bioRxiv - Immunology 2024Quote: ... The individual 25 µl volume 5’RACE PCR reactions were then carried out in 96-well plates using the thermocycler program recommended by the 5’RACE kit (Takara), with 35 cycles of gene-specific amplification with an annealing temperature of 60°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... BAC DNA or hL1-5’_3.3kb plasmids were purified using the NucleoBond® Xtra Midi Plus EF kit (Takara # 740422.50) following instructions for low-copy or high-copy plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... SLD3 and ESA1 ORF were PCR-amplified with Taq polymerase (MightyAmp ver. 2, Takara Bio Co., Otsu, Japan) and cloned into the BamHI sites of the Y2H DB vector pST1667 and the Y2H AD vector pST548 (Tanaka ...
-
bioRxiv - Cell Biology 2020Quote: ... transformed with pGEX-4T-2-Bbs5-WT in the presence of 0.1 mM isopropyl-β-D-thiogalactopyranoside (Takara). The proteins were purified with the glutathione-Sepharose 4B protein chromatography purification kit (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2020Quote: Freshly harvested sorted LT-HSCs were starved in PBS for 2 hours and then fixed onto RetroNectin (Clontech)-coated slides ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Neuroscience 2020Quote: ... cell content was ejected onto 1.1 µl drop of lysis buffer (0.1% Triton X-100, 2 U/µl TaKaRa RNAse inhibitor ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 µg of total RNA was subsequently reverse transcribed to cDNA using PrimeScript RT Master Mix (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized using 2 μg RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Gene specific primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 μg of RNA was reverse transcribed in a 20 μL volume with RT PCR master mix (TaKaRa) as per the manual instruction ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed using gene-specific primers (Table 2) and TB Green Premix Ex Taq (Takara). Levels of gene expression were normalized to that of 16S rRNA and expression was assessed for each biofilm and each timepoint relative to its planktonic counterpart using the 2−ΔΔCt method (43).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Yeast 2-hybrid library screening was conducted using the Matchmaker Gold Yeast Two-Hybrid System (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...