Labshake search
Citations for Takara Bio :
551 - 600 of 1338 citations for Acetamide N 5 bis 2 hydroxyethyl amino 2 2 chloro 4 6 dinitrophenyl azo 4 methoxyphenyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... About 2 μg of the isolated RNA was used to synthesize the first-strand cDNA using reverse transcriptase enzyme (Takara Bio, Clontech, USA). The cDNA was diluted seven times with sterile Milli-Q water (1:7 ratio) ...
-
bioRxiv - Cell Biology 2022Quote: ... Transformants were selected on synthetic media containing yeast nitrogen base (YNB, Difco) supplemented with 2 % glucose and DropOut supplements lacking uracil (Clontech, Mountain View, CA). Single colonies were used to inoculate 5 mL liquid YNB media supplemented with 2 % glucose and DropOut supplements lacking uracil ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... were transiently cotransfected with a 2:1 mixture of Nav1.7-expressing plasmid8 and a pIRES2-ZsGreen bicistronic plasmid (Takara Bio, San Jose, CA) expressing ZsGreen and mouse FHF2B proteins.10 The same pIRES2-ZsGreen plasmid without FHF2 coding sequence served as the control ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed by quantitative real-time polymerase chain reaction (PCR) using the AAVpro™ Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... containing a Kozak sequence added right before the ATG (RefSeq NC_045512.2) were synthesized by Eurofins (Ebersberg, EU) and subcloned into the pIRES2 vector with eGFP in the second cassette (Takara Bio Europe, EU). Truncated Δ4 and Δ8 E proteins ...
-
bioRxiv - Biochemistry 2024Quote: ... Sub-library specific primers were then used to amplify 1 ul of cDNA template for 24 cycles using Advantage 2 PCR Mix (Takara Bio, Cat. 639206). Finally ...
-
bioRxiv - Genetics 2024Quote: ... PCR was conducted as described earlier (section: RNAi-mediated knockdown of Pmtra-2) but using the proofreading PrimeSTAR HS DNA Polymerase (Takara Bio, Shiga, Japan) and Ex Taq DNA Polymerase (Takara Bio ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Neuroscience 2024Quote: ... a Tet responsive 2 promoter comprised of seven repeats of TRE binding sites and a minimal CMV promoter (based on that in Clontech’s pTRE2-hyg vector), a loxP site ...
-
bioRxiv - Genetics 2024Quote: ... Full-length cDNAs corresponding to SfVipR1 was PCR amplified using specific primers (Table 1) with reaction mixtures containing 25 μl 2×Gflex PCR buffer (Takara Bio, Shiga, Japan), 2 μl each of the sense and antisense primers (10 μM) ...
-
bioRxiv - Immunology 2022Quote: ... pmCherry-N’ (Clontech) between NheI and HindIII restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 °C for 45 min and the supernatants incubated with TALON beads (Clontech) pre-equlibrated with purification buffer at RT over night with overhead rotation followed by washing with wash buffer (8M urea ...
-
bioRxiv - Immunology 2021Quote: ... were coated overnight at 4°C with 20 μg/ml Retronectin (Takara T100B). Viral supernatant was spun for 90 minutes at 2,000g and 30°C onto the plated retronectin and half the supernatant volume removed carefully after spinning ...
-
bioRxiv - Pathology 2023Quote: ... Affinity purification was performed at 4°C using Talon metal affinity resins (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the supernatant was incubated with 4 ml TALON metal affinity resin (Clontech) at 4°C for 1 hr ...
-
bioRxiv - Neuroscience 2023Quote: ... fixed for 1 h in 4% paraformaldehyde/PBS (TAKARA BIO INC. Cat#T900), and subjected to antibody labeling ...
-
bioRxiv - Microbiology 2024Quote: ... each 100 μL reaction contained 4 μL Titanium Taq DNA Polymerase (Takara, #639242), 10 μL Titanium PCR buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Microbiology 2021Quote: ... The knockout construct was developed through In-Fusion using the purified amplicons based on the manufacturer’s instructions with the insert to vector ratio of 2:1 (Takara Bio, Mountain View, CA, USA) and transformed into E ...
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Microbiology 2024Quote: ... the ORF4 region was amplified by RT-PCR with specific primers (Supplementary Table S2) using PrimeScript One Step RT-PCR Kit Ver.2 (Takara Bio Inc., Kusatsu, Japan), following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... with 2 ul of RNAse inhibitor mix (containing 0.12 ul Triton X-100 10 %, 0.1 ul RNAse inhibitor (Takara (Cat. No. 2313B, 40 U/ul), 1.78 ul MilliQ water (RNAse-free)) ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Plant Biology 2020Quote: ... After 4 h total RNA was extracted using RNAiso Plus (Takara Bio, Shiga, Japan) according to the manufacturer’s protocol and used for real-time quantitative RT-PCR (qRT-PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was applied to 4-mL Talon Metal Affinity Resin (Clontech, cat# 635503). After washing with 30 mL wash buffer containing 20 mM HEPES at pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the larvae were fixed in 4% PFA for imaging or RNAiso Plus (Takara, 9109) for RNA isolation.
-
bioRxiv - Biophysics 2021Quote: ... The resultant supernatant was mixed with 4 mg of Talon Metal Affinity Resin (Takara) equilibrated with wash buffer [50 mM Na-Pi pH 8.0 ...
-
bioRxiv - Pathology 2023Quote: ... Affinity purification was performed at 4°C using Talon metal affinity resins (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Genomics 2024Quote: Approximately 4×106 HAP1 cells were transfected using Xfect Transfection Reagent (#631318, Takara Bio) for each pSpCas9(BB)-2A-Puro construct ...
-
bioRxiv - Neuroscience 2023Quote: ... the mouse monoclonal anti-GFP (Jl-8, Clontech; 1:500 overnight at 4°C) primary antibody was used ...
-
bioRxiv - Plant Biology 2022Quote: ... StNPR1 and StNPR3/4 were inserted also into the pGADT7 (prey) vector (Clontech, USA), to produce proteins with an N-terminal Gal4 activation domain ...
-
bioRxiv - Bioengineering 2024Quote: ... Cas9-EDVs were produced by seeding approximately 4 million Lenti-X cells (Takara Bio) into 10 cm tissue culture dishes (Corning ...
-
bioRxiv - Neuroscience 2024Quote: ... The PCR-amplified promoter fragments were inserted into the XhoI-AgeI site of the pAAV using Ligation high Ver.2 (LGK-201; Toyobo: hGFAP(ABC1D) or In-Fusion HD Cloning Kit (Takara Bio, Shiga, Japan: mMBP promoter).
-
bioRxiv - Developmental Biology 2022Quote: Trophectoderm biopsies containing 5-10 cells from blastocyst-stage embryos (n=24) were processed for RNA-seq using a commercial kit (Takara Bio ...
-
bioRxiv - Cancer Biology 2021Quote: ... at a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...
-
bioRxiv - Immunology 2021Quote: ... containing chilled (4°C) RNA lysis buffer (SMART-Seq HT lysis buffer, Takara Clontech, #634439). This contained the oligo-dT primer ...
-
bioRxiv - Immunology 2021Quote: ... containing chilled (4°C) RNA lysis buffer (SMART-Seq HT lysis buffer, Takara Clontech, #634439). This contained the oligo-dT primer ...
-
bioRxiv - Neuroscience 2022Quote: ... and either 4 wells of 10 pg of Human Universal Reference Total RNA (Takara 636538) or 2 wells of 10 pg of Human Universal Reference and 2 wells of 10 pg Control RNA provided in the Clontech kit ...
-
bioRxiv - Biochemistry 2024Quote: ... DNaseI-treated total RNA (4 µg) was reverse transcribed using Primescript reverse transcriptase (Takara Bio) and random hexamers (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... were used to prepare RNA-Seq libraries using the SMART-Seq v.4 Kit (Clontech) as previously described42 ...
-
bioRxiv - Synthetic Biology 2022Quote: Retroviral/lentiviral transductions were performed on days 3 and 4 post activation on retronectin (Takara) coated non-tissue culture treated plates ...
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 105 tumor cells in 6-well culture vessels were transfected with 5 μg DNA using XFect (Takara, Kusatsu, Japan) and clones were selected by puromycin (2-10 μg/mL).
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral media was then kept at 4°C before 100x concentration using LentiX concentrator (Takara #631232) and resuspension of virus in organoid seeding media ...