Labshake search
Citations for Takara Bio :
551 - 600 of 2411 citations for 7 Diethylamino 3 ethylamino 2 methylphenoxazin 5 ium tetrachlorozincate 2 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... in BrainPhys neuronal media (composed according to Bardy et al. 2015)74 and 2 µg/ml doxycycline (Takara 631311). Three days after plating and ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA encoding FLAG-Rhino was cloned into pPB-2× Ty1-Tjen-EGFP-P2A-BlastR51 using In-Fusion cloning (TAKARA), bearing pPB-FLAG-Rhino-Tjen-EGFP-P2A-BlastR ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... A mouse 7-day embryo cDNA Library (CATALOG No. 630478; Clontech Laboratories, Inc.) was used to identify host interaction proteins of Mtb PknG through yeast two-hybrid assay ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.125 μl Takara Ex Taq DNA Polymerase (5 U μl-1) (TaKaRa, Shiga, Japan), 2 μl of DNA and 15.67 μl nuclease-free water ...
-
bioRxiv - Developmental Biology 2022Quote: ... Three transformation reactions were performed with 2 µl of the reaction mixture in 50 µl Stellar− Competent Cells (636763, Takara) each according to the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2021Quote: ... The first stranded cDNA was next amplified to produce double stranded cDNA in 20 amplification cycles by long distance PCR using the Advantage 2 polymerase mix (Takara, Clontech) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... into individual wells of a 48-well plate (Brand) filled with 4 μl of a hypotonic lysis buffer containing 2 U/μL RNase inhibitor (Takara) and 0.2 % Triton-X-100 in Nuclease-free water ...
-
bioRxiv - Cell Biology 2019Quote: ... DNA was isolated from the expanded single colonies when confluent enough and used in PCRs using oligos to amplify exon 2 of CLN6 with CloneAmp HiFi PCR Premix (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... PCRs were performed on board using 25 ng of DNA from each coral sample with the Advantage 2 kit (Takara Clontech) and a final primer concentration of 0.5 μM in a final reaction volume of 50 μl ...
-
bioRxiv - Microbiology 2021Quote: 293T were transfected with full length SARS-CoV-2 Spikes and a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) using the calcium-phosphate method ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression of shRNA targeting and knocking-down Eklf was induced by the addition of 2 µg/ml of doxycycline (Clontech) for 96 hr ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... PreS2-LHBS sequence (deletion nucleotides 2-55) was cloned into the protein stability construct after the c-terminal of EGFP by In-Fusion cloning (Takara). The protein stability construct was a kind gift from Dr ...
-
bioRxiv - Microbiology 2022Quote: ... Each of these prey plasmids and previously constructed bait plasmids were co-transformed into Y2HGold yeast strain using Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformation mix was spread on DDO/X and QDO/X/A agar plates and incubated at 30°C for 3-5 days ...
-
bioRxiv - Microbiology 2022Quote: ... The purified ds cDNA and SmaI linearized pGADT7-Rec were co-transformed into Y187 yeast strain using Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformation mix was spread on to the SD/-Leu agar plates and incubated at 30°C for 3–4 days ...
-
bioRxiv - Genetics 2022Quote: ... and 2 ng of total RNA was amplified with SMART-Seq v4 Ultra Low Input RNA kit (Clontech; version “091817”). Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... covering the full-length SARS-CoV- 2 genome were amplified by PCR using a PrimeSTAR GXL DNA polymerase (TaKaRa Bio), the synthesized cDNA and specific primer sets from CoV-2-G1-Fw to CoV-2-G10-Rv designed previously (21) ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were then co-transfected with 150 ng of the pBiFC-HA-Casp2(S384E)-VC155 and pBiFC-HA-Casp2(S384E)-VN173 (mouse caspase-2) for BiFC and 10 ng of pDsRed-Mito (Clontech) as a transfection reporter plasmid ...
-
bioRxiv - Cancer Biology 2021Quote: ... whereas a TOPBP1 fragment corresponding to residues 2-1523 was amplified from pCDNA5-FRT/TO-LacR-FLAG-TopBP1 and cloned into pGBKT7 (Clontech/Takara) to create a fusion with the GAL4 DNA binding domain using the NdeI and XmaI sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was amplified by PCR in separate 25 μL reactions each containing 2 μL of cDNA for 11-13 cycles using 0.5 μL (2.5 U) LA Taq (Takara, Cat# RR002M) with P5-3’ and miRCat-PCR-2 oligos at an annealing temperature of 58°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Retrovirus supernatant or medium containing virus particles was harvested at day 2 post transfection and concentrated by Retro-Concentrator (Clontech) solution ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RNA quantification was performed by RT-qPCR targeting the S gene of SARS-CoV-2 using One Step PrimeScript RT-PCR Kit (Takara) with the following SARS-CoV-2 specific primers and probes ...
-
bioRxiv - Genetics 2019Quote: ... the yeast S.pombe SMC5 cDNA was PCR amplified by oLV511+oLV486 (Supplementary Table 2) and inserted into the NcoI–SalI digested pGBKT7 by In-Fusion cloning protocol (Clontech). Nse5 was cloned into pGBKT7 vector using NcoI and SalI sites and classical T4 ligase protocol.
-
bioRxiv - Biochemistry 2019Quote: ... Cells were transiently transfected either with GluK3EM or co-tansfected with Wild type/mutant receptors along with GFP expressing plasmid (2 µg/dish) using Xfect reagent (Clontech). Currents were recorded from medium sized cells expressing a moderate level of fluorescence from either the fused EGFP in case of GluK3EM or co-expressed EGFP and having a capacitance of ∼5-6 pF at 48-60 hours post transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 µg of RNA was used for the preparation of cDNA using PrimeScript Reagent Kit with gDNA eraser (Takara, Japan). Signal detection ...
-
bioRxiv - Zoology 2019Quote: ... were obtained from the mRho.V5.mER.hOr47a construct via PCR using the Advantage 2 PCR kit (Cat. Nr. 639206, Takara, Kusatsu, Japan) using the E.hOr47a_fwd and hOr47a_fwd forward primers ...
-
bioRxiv - Bioengineering 2019Quote: ... The vector harbored the URA3 and the leu2-d markers and the 2-m replication origin derived from the pYEX-S1 (Clontech) backbone ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both CnAOEC and ISO-HAS-B were cultured in Endothelial Cell Growth Medium 2 Kit (Takara Bio, Inc. Kusatsu, Japan). All cells used were routinely tested for Mycoplasma using PCR and were submitted to ICLAS Monitoring Center (Kawasaki ...
-
bioRxiv - Genomics 2019Quote: ... The transfected cells were cultured for 2 days and lentivirus were harvested and concentrated using the Lenti-X concentrator (Takara) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... 20-50ng of the first PCR amplicon in a total PCR reaction volume of 25ul was amplified in a 12 cycle PCR using primer set 2 and PrimeSTAR GXL DNA Polymerase (Takara) (Supplemental Table 1b) ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR was performed on 1 ml genomic DNA in a 25-ml reaction mixture (50 units/ml Taq DNA polymerase, W/Mg2+ buffer for DNA polymerase [Biocolors, Shanghai, China]; 2 mM dNTPs, [TaKaRa]). Thirty cycles of amplification were performed ...
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA (2 μg) was used to synthesize the first strand cDNA using SMARTTM MMLV Reverse Transcriptase (Takara Bio, USA). The synthesized cDNA was diluted seven times (1:7 ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated from 2 ng total RNA using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories) and amplified using 11 cycles of PCR ...
-
bioRxiv - Genomics 2020Quote: ... pseudoviridinutans was extracted from a 2-d-old culture using phenol-chloroform and NucleoBond buffer set III (TaKaRa, Shiga, Japan). The DNA was fragmented in an S2 sonicator (Covaris ...
-
bioRxiv - Developmental Biology 2022Quote: iPSCs SFCi55 and hESCs RUNX1-GFP were plated at 3 × 105 cells per a well of a 6 well plate and reverse transfected with 2 μg of DNA using the Xfect Transfection reagent (Clontech) and analyzed 2 days later.
-
bioRxiv - Microbiology 2022Quote: ... and E484Q mutations of the SARS-CoV-2 spike protein were determined by qPCR using mutation detection kits purchased from Takara Bio (Shiga ...
-
bioRxiv - Plant Biology 2022Quote: ... backbone with the FLAG and SV40 NLS (for version1) or without the FLAG and SV40NLS (for version 2) were amplified and assembled by TAKARA in-fusion HD cloning kit (cat639650 ...
-
bioRxiv - Microbiology 2022Quote: ... Ct values were obtained from PCR tests conducted as administrative tests at the Toyama Institute of Health using the SARS-CoV-2 direct detection RT-qPCR test kit from Takara Bio Inc ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence spanning the I-SceI cleavage site in the SceGFP gene was amplified from 150 ng of genomic DNA using Advantage 2 Polymerase (Clontech) with primers dr-for (5’-CCCGCCACCTGCCCCATCTGCTA ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: SseI gene was amplified from Salmonella typhimurium (STM) strain LT-2 strain using high fidelity DNA polymerase enzyme from TaKaRa and cloned in with N-terminal flag and HA tag in mammalian expression vector pcDNA3 flag HA Akt1 plasmid obtained from addgene(1477) ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... A total of 3.5 μl ribo-depleted material was used for SMARTer (SMARTer PCR cDNA Synthesis Kit, catalog num. 634926 and Advantage 2 PCR kit, catalog num. 639207, Clontech-Takara) protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Clarified lysate was then filtered through a 0.45 µm syringe filter and mixed with 2 mL of washed TALON® Metal Affinity Resin beads (Takara). The mixture was allowed to bind under nutation at 4℃ for 1 hr ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4×106 B cells per well were plated in 2 mL on 6-well plates that had been coated with RetroNectin (25 μg/mL, 4°C, overnight; #T100B, Takara), blocked with 2% BSA in PBS (1h ...