Labshake search
Citations for Takara Bio :
551 - 600 of 2081 citations for 6 Bromo 3 4 dihydro 2H 1 benzothiin 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... into which all possible combinations of 36 assays and 144 samples (127 woodchip samples, 16 standards, and one no-template control) were loaded by the SmartChip MultiSample NanoDispenser (Takara Bio). In brief ...
-
bioRxiv - Microbiology 2022Quote: ... the viral RNA was isolated and amplified by RT-PCR using the PrimeScript II High Fidelity One Step RT-PCR Kit (Takara Bio) and specific primers ...
-
bioRxiv - Microbiology 2022Quote: ... The reverse transcription and the first round PCR were performed in a 25μl reaction volume by using PrimeScript™ One-Step RT-PCR Kit (TAKARA, RR055A). Cycling conditions were as follows ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant constructs were introduced into Y1H gold strain and Y1H assay was performed using Matchmaker® Gold Yeast One-hybrid screening system (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, Cat# RR096A) and the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, Cat# RR096A) and the following primers ...
-
bioRxiv - Microbiology 2023Quote: ... as previously described (17): pcDNA3.1+-based plasmids used for ectopic expression and pRetroX-tight-Puro-based ones (Clontech, cat. PT3960-5) used here to generate stable cell lines expressing ISG20 upon induction with doxycycline (dox.) ...
-
bioRxiv - Microbiology 2023Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using a One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, Cat# RR096A) and the following primers ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was performed in a single-step using the One-Step TB Green PrimeScript RT-PCR Kit II (Takara Bio). The HCoV-OC43 nucleocapsid gene was amplified with the following primers ...
-
bioRxiv - Microbiology 2023Quote: ... and quantified by RT‒qPCR using Primer/Probe N2 (NIHON GENE RESEARCH LABORATORIES, INC. Miyagi, Japan) and One Step PrimeScript™ III RT‒qPCR Mix (TaKaRa) with CFX96 (Bio-Rad ...
-
bioRxiv - Zoology 2024Quote: ... RNA was extracted using Isogen-LS (Nippon Gene) and RT-qPCR was performed using the One-Step PrimeScript RT-PCR Kit (Takara Bio) on a 7500 Real-Time RT-PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... 90 μl of RNase free water was added and then 2.5 μl of diluted sample was used for real-time RT-PCR according to the manufacturer’s protocol with One step TB green PrimeScript PLUS RT-PCR Kit (Takara, Cat# RR096A) and primers for Nucleocapsid (N ...
-
bioRxiv - Microbiology 2023Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using One Step TB Green PrimeScript PLUS RT-PCR kit (Takara, Cat# RR096A) and the following primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the primers described previously(6) and cloned into pmCherry-C1 (Takara Bio Inc., San Jose, CA). To silence HNRNPK expression ...
-
bioRxiv - Genetics 2022Quote: ... then combined with 6 µL cDNA and 15 µL Mighty Mix T4 DNA ligase reaction mix (Takara) and incubated overnight at 16 °C ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and spun for 30 min (1,200 x g ...
-
bioRxiv - Microbiology 2020Quote: ... Cellular RNA was isolated at 6 hpi using the CellAmp Direct RNA Prep Kit (3732; Takara, Japan). The RNA was then diluted in water and boiled ...
-
bioRxiv - Plant Biology 2020Quote: One µg of total RNA was used to generate cDNA with the SMARTer PCR cDNA Synthesis kit (Clontech, Mountain View, CA, USA). Fifty µl of cDNA were amplified by 13 PCR cycles with the Kapa HiFi PCR kit (Kapa Biosystems ...
-
bioRxiv - Molecular Biology 2019Quote: ... LINC00662 (NR_027301) and ELK4 (NM_001973.4) were detected by One-Step SYBR PrimeScript RT-PCR Kit (Perfect Real Time; Takara Bio, Inc., Kusatsu, Japan). Relative expression values were calculated using the relative quantification (2−△△Ct ...
-
bioRxiv - Plant Biology 2020Quote: ... and one microgram of the DNase-treated RNA was used for cDNA synthesis using PrimeScript RT reagent kit (Takara Bio, CA, USA). The expression analysis was performed using TB green Premix Ex Taq II (Takara Bio ...
-
bioRxiv - Genetics 2020Quote: ... First-round reverse transcription PCR (RT-PCR) was conducted by using PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa, Dalian, China). A 10 μL reaction mixture contained 5 μL of 2 × 1 Step Buffer ...
-
bioRxiv - Pathology 2021Quote: ... The number of SARS-COV-2 copies were quantified using Direct One-Step RT-qPCR Mix for SARS-CoV-2 kit (Takara Bio Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... cDNA were amplified from the embryo RNA using PrimeScript™ II High Fidelity One Step RT-polymerase chain reaction (PCR) Kit (Takara, R026A) using the following primers ...
-
bioRxiv - Plant Biology 2022Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB93 using Taq polymerase (Takara Bio Inc. Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using a One-Step SYBR Green Prime ScriptTM RT-PCR Kit II (Perfect Real Time, Clontech, Takara, Kyoto, Japan) with a Thermal Cycler Dice™ system (Takara ...
-
bioRxiv - Immunology 2022Quote: ... The day before transduction, a non-tissue culture treated 24-well plate (Grener Bio one, #662102) was coated with retronectin (Takara Bio, #T100B) in PBS (7μg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: The MDM4 coding sequence (NM_002393.5) was cloned into Lenti-X™ Tet-One™ Inducible Expression System (Takara Bio, cat. no. 631847). The resulting plasmid was then subject to whole-plasmid sequencing for verification ...
-
bioRxiv - Microbiology 2023Quote: ... levels were measured by a qRT-PCR assay using the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (TaKaRa, Cat# RR096A). The PCR protocol was 42°C for 5 min ...
-
bioRxiv - Plant Biology 2023Quote: ... The expression of marker genes was detected by qRT-PCR using the One-step TB Green PrimeScriptTM RT-PCR kit II (Takara, Osaka, Japan). All genes were normalized against the level of an actin reference gene (Foo et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB50 using Taq polymerase (Takara Bio Inc., Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... vRNA copy numbers of each virus stock were measured via RT-qPCR assay with the One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (TaKaRa, Cat# RR096A) as described previously [12] ...
-
bioRxiv - Microbiology 2023Quote: Standards for determining copy number of virus stock were prepared using the PrimeScript II High Fidelity One Step RT-PCR Kit (TaKaRa, Cat# R026A) with IAV (H1N1 ...
-
bioRxiv - Genetics 2024Quote: ... GFP-fused Actb WT and S348L in pcDNA3-GFP were amplified using KOD One (TOYOBO, Osaka, Japan) and cloned into pCSf107mT[31] using the In-Fusion HD Cloning Kit (Takara, Shiga, Japan) resulting in pCSf107mT-GFP-Actb WT and S348L ...
-
bioRxiv - Genomics 2024Quote: ... and one microgram of the DNase-treated RNA was used for cDNA synthesis using PrimeScript RT reagent kit (Takara Bio, CA, USA). The expression analysis was performed using TB green Premix Ex Taq II (Takara Bio ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Yeast-two-hybrid analysis was performed according to the Matchmaker 3 manual (Clontech). S ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...