Labshake search
Citations for Takara Bio :
551 - 600 of 1126 citations for 5H Cyclopenta b pyridine 3 carboxylicacid 2 amino 6 7 dihydro ethylester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cell Biology 2022Quote: ... and in-chip reverse transcription PCR were performed using a 3’ DE Chip and Reagent kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
bioRxiv - Bioengineering 2024Quote: ... CD11b-specific amplicons were generated via 3-step nested PCR using PrimeSTAR GXL (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol with a 60°C annealing temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retroviral transduction was achieved by spinoculation of 3 × 106 mouse T cells on retronectin-coated plates (Takara Bio) with neat retroviral supernatant harvested from 293T packaging cells (2000xg ...
-
bioRxiv - Plant Biology 2024Quote: ... and inserted into BamHI-digested pGEX-4T-3 by using In-Fusion Smart Assembly Cloning Kit (Takarabio-Clontech). Full-length OcKSL4 cDNA was amplified by RT-PCR using primers 5’-GGATCCATGGCGAATTATCCCATGGAG-3’ (forward ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at –80 °C.
-
bioRxiv - Developmental Biology 2020Quote: ... Yeast transformation was conducted with Yeast Transformation System 2 (Clontech NO.630439). All primers used were listed in supplementary Table 1.
-
bioRxiv - Microbiology 2020Quote: ... 2 µl of dNTP mix (TaKaRa, 2.5 mM concentration, 200 µM final), 0.125 µl of HotStart ExTaq (TaKaRa ...
-
bioRxiv - Microbiology 2019Quote: ... ISC5 and ISC5 groups using Advantage 2 Polymerase Mix (TAKARA, Kusatsu, Japan). 2µl of template with varying DNA concentration were used in a total of 50µl PCR reaction (S1 Dataset A) ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... the cDNA was amplified with the Advantage 2 PCR Kit (Clontech Takara) containing buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... 2% (w/v) glucose unless specified and the appropriate dropout (Takara Bio) solution for selection ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 μl lysis buffer per well (1:20 RNase inhibitor (Clontech) in 0.2% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... before loading into a TALON® 2 ml Gravity Column (Takara 635606). Columns were washed one additional time before elution in a single step (150 mM Imidazole ...
-
bioRxiv - Microbiology 2022Quote: ... a set of primer/probe E484A (SARS-CoV-2) (Takara, Cat# RC322A) was used ...
-
bioRxiv - Microbiology 2022Quote: ... 1µl of cDNA was amplified using Advantage HF 2 DNA polymerase (Takara) for 30 cycles according to the manufacturer’s instructions (forward primer ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.5 mM dNTP and 2 U/mL of recombinant RNase inhibitor (Clontech) then spun down and frozen at −80°C ...
-
bioRxiv - Cell Biology 2019Quote: ... 200 nM SELECT primers and 2 x SYBR Green Master Mix (TaKaRa). SELECT qPCR program was perform as following condition ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 2% (w/v) glucose unless specified and the appropriate dropout (Takara Bio) solution for selection ...
-
bioRxiv - Immunology 2020Quote: ... Whole transcriptome amplification (WTA) was performed with Advantage 2 polymerase (Takara Bio). WTA reactions were monitored with qPCR to determine optimal cycle number ...
-
bioRxiv - Synthetic Biology 2021Quote: ... After 2 days of incubation on selective media (SC-URA/630314/CLONTECH) at 30°C ...
-
bioRxiv - Microbiology 2021Quote: ... cerevisiae strain BJ5464 using protocol Yeastmaker™ Yeast Transformation System 2 (Clontech). The transformants were screened on yeast nitrogen base (YNB ...
-
bioRxiv - Cell Biology 2022Quote: ... The cells were then treated with 2 μg/mL puromycin (Clontech; 631306) under selection for at least 1 week ...
-
bioRxiv - Neuroscience 2022Quote: ... Lentiviruses were purified and concentrated using the LentiX Concentrator (Clontech, PT4421-2) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at-80°C ...
-
bioRxiv - Genetics 2023Quote: ... cDNA was amplified and purified using an Advantage 2 PCR Kit (Clontech). The cDNA library was sequenced using an Illumina sequencing platform (NovaSeq6000) ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was incubated with 2 ml Ni-IDA resin (Takara Bio) for 2 hrs at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 different reporters were tested in parallel: pE2F-TA-Luc (Clontech/Takara) to measure E2F transcriptional activity (repressed by Rb) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 different reporters were tested in parallel: pE2F-TA-Luc (Clontech/Takara) to measure E2F transcriptional activity (repressed by Rb) ...
-
bioRxiv - Cancer Biology 2023Quote: ... then cells were selected with 2 μg/ml puromycin (631306; Takara Bio) or 500 μg/ml geneticin (10131027 ...
-
bioRxiv - Microbiology 2024Quote: ... according to the supplier’s protocol (ClonTech; Protocol-at-a-Glance, PT5056-2). The E.coli strains were cultured in LB broth medium supplemented with ampicillin ...
-
bioRxiv - Systems Biology 2021Quote: ... We prepared ligation-free ribosome profiling and total RNA-seq libraries from the clarified polysome lysates treated for 6 hours following the instructions provided with their respective kits (smarter-seq smRNA-seq kit, Takara-Clontech; NEBnext Ultra-Directional II) augmented with our previously-published ligation-free ribosome profiling protocol42 ...
-
bioRxiv - Immunology 2022Quote: ... and integrinβ7+ MCs from both ears of NT mice (n = 5) and MC903-treated mice (n = 6) were collected into CDS sorting solution (Takara Bio Inc, Shiga, Japan) using 96 well plate ...
-
bioRxiv - Immunology 2023Quote: ... The 6-His tagged recombinant proteins were purified from the supernatant by gravity-fed through TALON® Metal Affinity Resin (Takara Bio, Shiga, Japan). Following a wash step with PBS (pH 8) ...
-
bioRxiv - Cancer Biology 2023Quote: Retroviral supernatant was collected two and three days after transfection of GP2-293T cells and concentrated onto wells of a 6 well plates coated with Retronectin (Takara Bio, 5 ug/ml) by spinning at 2500g for 90 minutes at 32° C ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were single-cell sorted into 96-well low-bind PCR-plates [Eppendorf] containing 3 μl of lysis buffer (0.5 units/μl RNase inhibitor [Takara] ...
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’-RACE and 3’-RACE reactions were performed with the Smart RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The final supernatant was supplemented with NaCl to 150 mM and incubated with 3 mL His60 resin (Takara Biosciences) for 30 min ...
-
bioRxiv - Cancer Biology 2020Quote: Libraries were prepared using 1ng of purified cDNA according to the ICELL8® 3’ DE instruction manual (Takara Bio) using the Nextera Primer P5 (ICELL8® 3’ DE Kit ...
-
bioRxiv - Microbiology 2021Quote: The LTR promoter of the HIV-1 laboratory strain pNL4-3 was cloned into the pTA-Luc backbone (Clontech) and is henceforth referred to as pTA-Luc-NL4-3 ...
-
bioRxiv - Immunology 2022Quote: The sequence of anti-IFNγ was cloned from XMG1.2 hybridoma (ATCC) using SMARTer RACE 5’/3’ kit (Takara Bio). The 6xHis tagged anti-Dsg ...
-
bioRxiv - Bioengineering 2022Quote: About 130 ml of clarified cell suspension was combined with 3 mL of TALON® resin (Takara Bio 635503) previously equilibrated in lysis buffer and rocked at 4°C for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: The s2m sequence or control scrambled sequence of s2m (s2m_scr) was inserted into the 3’ UTR of GFP in H6P plasmid using In-Fusion Cloning kit (TaKaRa) and verified by sequencing ...