Labshake search
Citations for Takara Bio :
551 - 600 of 1816 citations for 3' Methyl 1 1' biphenyl 4 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSFDUET-1-EIF6 plasmid was co-transformed with pG-KJE8 expressing five bacterial chaperones (5-Ch: DnaK-DnaJ-GrpE, GroES, GroEL) or pG-TF2 expressing 3 bacterial chaperones (3-Ch: GroES, GroEL, TF) (Takara Biosciences) in BL21 (DE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Biochemistry 2024Quote: ... for A3>P: 5’-aaaacacugaaccug-3’ for A2>P: 5’-aaacacugaaccug-3’) were incubated with 10 U recombinant MazF (Takara Bio) in 20 mM Tris pH 8.0 ...
-
bioRxiv - Genetics 2024Quote: ... The 4–11 kb fragments of the DFR-B sequence were amplified by PCR using the primers DP-LF (5′-TTAACATGAGGGGATTGCATGTCACTTTCA-3′) and D3U-LR (5′-CATAAATCTGGTTCGAGTGGCAATCTAACT-3′) with Ex-Premier DNA Polymerase (TAKARA, Japan). The PCR conditions were as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies were directed against IBA1 (rabbit-anti-iba1 WAKO chemicals 019-19741 1:1000) and tdTomato (mouse-anti-dsRed Takara 632392 1:1000). Secondary antibodies were goat anti-rabbit or anti-mouse conjugated with Alexa dyes 488 and 568 (1:1000) ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-nc82 (mouse, 1:10; Developmental Studies Hybridoma Bank, Iowa City, IA, USA) and anti-DsRed (rabbit, 1:500; Takara Bio, Kyoto, JP). Brains were washed three times again in PBS with 0.2% Triton X-100 and transferred into secondary antibody solution (anti-chicken Alexa Fluor 488 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq, TaKaRa Bio, Shiga, Japan), 2.5 µL PCR Buffer 10X ...
-
bioRxiv - Neuroscience 2023Quote: ... the brain slices were first blocked in 10% goat serum made in 0.1% Triton X-100/1× PBS and then incubated in anti-GFP antibodies (1/1000, RT, overnight, Mouse anti-GFP, 632381, Takara Bio USA, WI) followed by Alexa-488 secondary antibodies (1/200 ...
-
bioRxiv - Neuroscience 2023Quote: ... the samples were incubated in primary antibody (chicken anti-GFP, Abcam #13970, 1:2000, rabbit anti-DsRed, Takara Bio Clontech #632496, 1:200) for 24 – 48 hours in the dark while shaking at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... the samples were incubated in primary antibody (chicken anti-GFP, Abcam #13970, 1:2000, rabbit anti-DsRed, Takara Bio Clontech #632496, 1:200) for 24 – 48 hours in the dark while shaking at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissues were rinsed four times for 15 min each with 0.1 M PBS and incubated with secondary antibodies anti-DsRed (1:500; RRID:AB_10013483; Living Colors DsRed polyclonal; Takara Bio USA, San Jose, CA) and anti-Troma1 (1:500 ...
-
bioRxiv - Bioengineering 2023Quote: ... the input binary libraries (1:10 or 1:100) and the selected pools were subjected to restriction digestion using BamHI (Takara Bio Inc., Japan). The digestion products were then analyzed using a 10% polyacrylamide gel electrophoresis (PAGE ...
-
bioRxiv - Genomics 2021Quote: ... 4 ul 2.5 μM dNTP mixture (Takara), 0.8 ul 100mM DTT and 14.2 ul RNase-free water ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μM random hexamer primers (Takara Bio ...
-
bioRxiv - Microbiology 2020Quote: ... and 4) TaKaRa LA Taq (TaKaRa RR042). For each library ...
-
bioRxiv - Microbiology 2024Quote: ... PrimeScript reverse transcriptase (4 µl) (Takara, #2680B), and filtered water (6 µl ...
-
bioRxiv - Molecular Biology 2020Quote: ... was amplified using specific primers (forward: 5’-AAGGAGATATACATATGCTCTCCGAAATGGTGGAAGAAG-3’; reverse:5’-GTGCGGCCGCAAGCTTTTATTTCTTTTTGTTGGTGGTCTG-3’) and cloned into pET28a using an InFusion HD Cloning Kit (Takara Bio USA) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... Expression plasmids for Env and associated mutants in addition to Gag were natively expressed from the reference HIV-1 clone NL4-3 with the following modifications: the pNL4-3 vector was sub-cloned into an SV40 ori-containing backbone (pN1 vector; Clontech; pSVNL4-3), deletion of pol by removal of the BclI-NsiI fragment ...
-
bioRxiv - Genetics 2020Quote: ... To determine the 5’ and 3’ UTR of the sds3 gene 5’ and 3’ Rapid amplification of cDNA ends (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara Bio) on RNA isolated using Trizol (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: Mouse IL-27 p28 3′UTR plasmid was cloned by inserting p28 3′UTR into MCS of the pEGFP-C1 vector (Clontech, California US) between XhoI and KpnI sites ...
-
bioRxiv - Microbiology 2024Quote: The 5’ and 3’ termini of the sRNA OueS were determined by the RACE assay (SMARTer RACE 5’/3’ kit, Takara Bio USA), adapted for non-poly-A-tailed RNA ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid pGEX-6p-3-lev-11A was generated by seamlessly cloning lev-11A cDNA into pGEX-6p-3 by In-Fusion cloning (Takara, Shiga, Japan). For expression of mCherry-tagged LEV-11 isoforms in body-wall muscle ...
-
bioRxiv - Immunology 2020Quote: ... Then subsequent primary antibody incubation was done overnight at 4 degrees (all primary antibodies were diluted in 1% blocking milk or for Phos-tag with MBL Max blot solution 1 or Takara Western blot immune booster). Proteins of interest were detected with Anti-Rabbit IgG HRP (Cell signaling technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... crossed with WT BDF1 males at E0.5 and electroporated with RNP complex of Mavs targeting sgRNA (100 ng μL-1) and Cas9 protein (Takara Bio; 500 ng μL-1) using NEPA21 electroporator ...
-
bioRxiv - Immunology 2021Quote: ... and 3 U Recombinant RNase Inhibitor (Takara, Cat#2313A), sealed and immediately frozen on dry ice ...
-
bioRxiv - Microbiology 2023Quote: ... to amplify the 3’ end and CloneAmp (Takara Bio) for amplification of the 5’ end.
-
bioRxiv - Developmental Biology 2022Quote: A Smart-seq v4 3’ DE Kit (Takara Bio) was adapted to DRaqL as follows ...
-
bioRxiv - Microbiology 2021Quote: ... Clarified lysates were loaded onto a 1 mL TALON (Takara) column ...
-
bioRxiv - Genetics 2021Quote: ... and a 1:5000 dilution of anti-GFP (Takara, 632381). Blots were washed (3 × 10 mins ...
-
bioRxiv - Neuroscience 2021Quote: ... or 1× Nested Universal Primer (secondary PCR, Clontech Laboratories, Inc.) and gene-specific primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit polyclonal anti-Tomato (Clontech Cat. #: 632496, dilution 1:400) and chicken polyclonal anti-GFP (Abcam Cat ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-DsRed (1/1,000, rabbit, Clontech Laboratories, Inc., Cat# 632496), and anti-cleaved caspase3 (1/500 ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-E-Cad 1:200 (M108, clone ECCD-2, TaKaRa), anti-Nanog 1:200 (eBIO-MLC51) ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-DsRed (Clontech, Cat. No. 632496, 1:500). All secondary antibodies were purchased from Jackson ImmunoResearch and used at 1:400 dilution ...
-
bioRxiv - Neuroscience 2021Quote: ... and rabbit anti-DsRed (1:500, Takara Bio Cat# 632475) with secondary antibodies goat anti-chicken 488 (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used were mouse anti-STEM121 (1:500; Takara), chicken anti-GFAP (1:2,000 ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μL PrimeSTAR GXL Polymerase (R050B, Takara Bio, Kusatsu, Japan), 1 μL dNTPs ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.67 U μl−1 Recombinant RNase Inhibitor (Takara Bio, 2313B), 1.67× First-Strand Buffer (Takara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... STEM121 (human cytoplasm, 1:2000; Y40410, Takara, Mountain View, CA), overnight at room temperature to detect engrafted cells ...
-
bioRxiv - Neuroscience 2021Quote: ... spiked with 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1 U/μl recombinant RNase inhibitor (Takara Cat.no. 2313A), pH ∼7.25 was prepared ...
-
bioRxiv - Neuroscience 2020Quote: ... spiked with 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... a WST-1 cell proliferation assay kit (MK400, Takara Bio) was used according to the manufacturer’s instructions ...