Labshake search
Citations for Takara Bio :
501 - 550 of 5354 citations for Rat Insulin Like Growth Factor Binding Protein 5 IGFBP5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... His-tagged QUEEN protein was bound to TALON Metal Affinity Resins (Clontech) at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: Purified proteins or polymers were diluted using 1× PBS (Takara Bio, T900), and loaded into custom-made microneedles prepared with the P1000IVF micropipette puller (Sutter Instrument) ...
-
bioRxiv - Plant Biology 2022Quote: ... CITRINE-fusion proteins were detected with anti-GFP antibody (JL-8, Takara Bio Clontech ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells stably expressing the tetracycline-controlled transactivator protein (Tet-ON, Clontech) were cultured in DMEM with 10% FBS and grown at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... Purification tags were removed by treating recombinant proteins with HRV3C protease (TaKaRa) and cOmplete™ His-tag Purification Resin (Roche) ...
-
bioRxiv - Plant Biology 2023Quote: ... the fusion protein was purified using TALON® Cobalt resin (Takara Bio). Following extensive washing in a buffer containing 20 mM HEPES (pH 7.5) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... His-tagged proteins were purified with His60 Ni Superflow resin (TaKaRa; 635677) according to the manufacturer’s instructions ...
-
Pyruvate kinase M2 regulates Japanese encephalitis virus replication by interacting with NS1 proteinbioRxiv - Microbiology 2024Quote: ... Pre-incubated samples were loaded onto the Capturem protein A columns (TaKaRa) and centrifuged at 1000g for 1 minute at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... In-fusion HD kit and In-Fusion Snap Assembly kit (TaKaRa). pRSETa_mEos4b was a gift from Loren Looger (Addgene plasmid #51073 ...
-
bioRxiv - Cancer Biology 2023Quote: ... LipofectamineTM 2000 kit and reverse transcription kit were purchased from TaKaRa Company ...
-
bioRxiv - Immunology 2024Quote: ... The RNeasy kit and the cDNA Synthesis Kit (Takara, Cat#: 9767, RR047A) was used to extract total RNA and prepare cDNA following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of HotStart ExTaq (TaKaRa, 5 U/µl, 0.625 U/µl final), 1 µL reverse primer (10 µM concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A total of 5 ml of Talon Metal Affinity Resin (Takara Bio USA) was added to the supernatant and mixed overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 MOI retrovirus and 5 µg/cm2 RetroNectin reagent (Takara, Cat. No. T100A) were used in the transduction following the manufactory protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μL of 2× SYBR Premix Ex Taq II (TaKaRa, Beijing, China), 1 μL of cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction system included 5 μL SYBR® Premix Ex TaqTM (Takara, China), 1 μL template ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl of 10X ExTaq buffer and 0.375 μl of ExTaq polymerase (Takara) and water to a final volume of 50 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR mixture contains 5 ul EmeraldAmp GT PCR Master Mix (Takara, #RR310B), 1 ul genomic DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 U Takara Epi Taq HS (Takara, cat. no. R110A, 5 U/µl), 2.5 mM MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was loaded onto a 5-ml TALON metal affinity resin (Clontech) equilibrated in loading buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was incubated with 5 ml of TALON resin (Takara Bio) for 90 min at 4°C ...
-
Diversified expression of gamma-protocadherins regulates synaptic specificity in the mouse neocortexbioRxiv - Neuroscience 2021Quote: LATaq Kit (RR002B, TaKaRa) was used in nested PCR ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Biophysics 2019Quote: ... the detergent-solubilised protein were batch bound to Co2+-charged Talon resin (Clontech) by gentle rotation at 4 °C for 1 h ...
-
bioRxiv - Systems Biology 2021Quote: ... the inducible fluorescent protein was induced by adding 1 μg/ml doxycycline (Clontech) alone or together with 100 nM rapamycin (Harveybio ...
-
bioRxiv - Neuroscience 2021Quote: ... the fluorescent proteins were amplified from pAM FLEX eGFP and pmCherry-C1 (Clontech) respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... 6xHis tagged proteins were purified using Talon Co2+ affinity resin (Takara Bio, USA) and eluted with 150 mM Imidazole in the lysis buffer pH 7.8 ...
-
bioRxiv - Microbiology 2021Quote: ... The protein bands were visualized using the Western BLoT Hyper HRP Substrate (TAKARA) and exposed using a Chemiluminescence Imaging System (Fusion Solo S ...
-
bioRxiv - Cell Biology 2022Quote: Every protein expressed in mouse rods was also cloned into pEGFP-N1 (Clontech) for expression in AD293 cells using the AgeI and NotI cloning sites within the vector to replace EGFP with the tagged proteins ...
-
bioRxiv - Plant Biology 2020Quote: ... Transferred proteins were first probed with anti-GFP (Takara Bio, 1:5,000 dilution) for 16 h ...
-
bioRxiv - Biochemistry 2019Quote: ... the Rab8A proteins were co-expressed with the chaperone GroEL/S (pGro7, Takara). The expression of the GroEL/S chaperone was auto-induced by supplementing the LB-medium with 1 mg/mL arabinose.
-
bioRxiv - Biochemistry 2021Quote: ... Proteins in the supernatant were purified by the affinity chromatography with TALON (Clontech) resin ...
-
bioRxiv - Cell Biology 2020Quote: ... Shield-1 ligand for stabilization of DD-tagged proteins was purchased from Takara Bio (Cat # 632189 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monoclonal U-2OS cell lines stably expressing Tet-On 3G transactivator protein (Clontech), a tandem-dimeric MS2 hairpin binding protein tagged with eYFP (MS2CP-YFP) ...
-
bioRxiv - Cell Biology 2023Quote: ... for GST-tagged protein or on TALON-Cobalt beads column (635507, Takara Bio) for 6XHIS-tagged protein as previously described [19,26] ...
-
bioRxiv - Cell Biology 2023Quote: For mammalian expression of eGFP labelled proteins we used the pEGFP-C1 (Clontech) vector ...
-
bioRxiv - Developmental Biology 2023Quote: ... which was induced for protein purification using Talon Metal Affinity Resin (Takara 635501). Two New Zealand white rabbits were injected at ten sites with 500μl of Freund’s Complete Adjuvant (Sigma-Aldrich F5881 ...
-
bioRxiv - Biochemistry 2023Quote: ... MA) and the protein was purified using Talon beads (Takara Bio Inc., Japan) following published protocols 37,38 ...
-
bioRxiv - Neuroscience 2023Quote: ... the fluorescent proteins were amplified from pAM FLEX eGFP and pmCherry-C1 (Clontech) respectively ...
-
bioRxiv - Plant Biology 2024Quote: ... The JMJ27-GFP fusion protein was detected using the anti-GFP (Takara: 632593) 1:2,000 (v ...
-
bioRxiv - Microbiology 2024Quote: ... The fusion protein was affinity-purified using TALON metal affinity resin (Takara Biosciences) and eluted in buffer containing 50 mM Tris-HCl ...
-
Effects of Sanhuang plaster on expression of MyD88, TRAF6, MIP-1β and IL-23 in rats infected by MRSAbioRxiv - Molecular Biology 2022Quote: ... Real-time fluorescence quantitative PCR kit and reverse transcription kit(TaKaRa Co., Ltd.); MyD88 Anti-body TRAF6 Anti-body MIP-1β Anti-body and IL-23 Anti-body (GeneTexCo. ...
-
bioRxiv - Biophysics 2020Quote: ... using a cDNA synthesis kit (PrimeScript 1st strand cDNA Synthesis Kit, Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Adeno-X Maxi Purification Kit and Adeno-X Rapid Titer Kit from Clontech were used for purification and titration ...
-
bioRxiv - Cancer Biology 2023Quote: ... Adeno-X Maxi Purification Kit and Adeno-X Rapid Titer Kit from Clontech were used ...
-
bioRxiv - Genetics 2021Quote: The PCR reaction mixture contained 0.05 μl Ex Taq polymerase (5 U/μl, TAKARA), 1μl 10X Ex Taq Buffer (20 mM ...
-
bioRxiv - Microbiology 2019Quote: ... cells were transiently transfected with 5 µg of the pTRE3G-Luc control vector (Clontech) using Lipofectamine LTX (see above) ...